Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Autonomic neuropathy It leads to dry skin due to decreased sweating. Dryness of the skin leads to cracking which makes entry of infection in to the deeper plane eas
Explain about the Biosensors and Caramelization? Biosensors: A device that utilizes biological materials to monitor the presence of several chemicals in a substance. Carame
Is there a respiratory pigment in the annelid blood? The blood in beings of the phylum Annelida have the respiratory pigment hemoglobin (the similar found in chordates) and oth
Doppler echocardiogaphy is based on the Doppler effect, which was described by the Austrian phy$icist Christian Doppler in 1842. The Doppler effect states that sound frequency
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Strain of Fusarium moniliforme? It was first obtained from a strain of Fusarium moniliforme isolated from southern leaf blight- damaged corn seed as a water soluble toxin.
Explain what is Light Microscope - Microscopy Modern light microscopes are compound microscopes. Here the magnified image formed by the objective lens is further enlarged by on
Explain Prosoma in details. First tagma of a cheliciform consisting of the first six segments of the body. Appendages on the prosoma are involved in locomotion and feeding. Pro
State the term in brief -Asconoid sponge? Of the three different sponge architectures, it is the simplest. It comrpsies a central choanocyte lined spongocoel which opens to the
Q. Show the Impressions at first - Transitional Restorations? The dental technique will have modified the abutment to the desired shape and will now be able to fabricate the tr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd