Cutaneous respiration in frog, Biology

Assignment Help:

Cutaneous respiration in frog

  1. Frog belongs to class Amphibia under vertebrates.
  2. It is an amphibious animal which can live both on land and in water.
  3. Skin is very important organ through which one third of the total oxygen is obtained.
  4. When it is in water it respires through skin.
  5. Frog always keeps its skin moist, because it secretes mucous on to the skin (Mucous layer).
  6. The mucous layer retains water and reduces evaporation of water from body.
  7. To keep the skin wet and moist, frogs jump into water very frequently.
  8. Exchange of gases take place through skin.

Related Discussions:- Cutaneous respiration in frog

Poultry and duck diseases-infectious laryngotracheitis (ilt), Infectious la...

Infectious laryngotracheitis (ILT) Infectious laryngotracheities, caused by fowl Gallid Herpesvirus 1 belonging to the family Herpesviridae, is a quickly spreading acute res

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine majority of segregation errors in human patients, Which of the fo...

Which of the following defines why the vast majority of segregation errors in human patients include the two sex chromosomes (XXY, XO, XYY) or chromosome 21 (triple 21)? A. The

Do all vascular plants develop annual rings, Do all vascular plants develop...

Do all vascular plants develop annual rings? Vascular plants are those, which have phloem and xylem structures within them to transport water and nutrients around the plant. Mo

Define microorganism in fermentation foods process, Normal 0 fa...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Define the bacillus cereus, Define the Bacillus cereus Bacillus cereus ...

Define the Bacillus cereus Bacillus cereus is not a common cause of food poisoning. It is a Gram positive, aerobic, spore forming rod shaped bacteria normally present in soil,

Minerals requirements during congestive cardiac failure, Q. Minerals requir...

Q. Minerals requirements during congestive cardiac failure? Minerals: Since sodium and potassium are the major electrolytes associated with oedema, it is important that sodium

Dietary management of diverticular disease, Q. Dietary Management of divert...

Q. Dietary Management of diverticular disease? Most of the diseases which we have discussed so far do not require any major changes in the nutrient intake. The patients general

Cnidaria and platyhelminthes - larval forms, Cnidaria and Platyhelminthes -...

Cnidaria and Platyhelminthes - Larval forms Cnidaria The common larval stage that is found in cnidarians is the planula which forms following gastrulation. The planula is

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd