Cromngnon skull, Biology

Assignment Help:

Subsequently many such fossils were known from France, Italy and middle East. All such fossils exhibited reduced brow ridges, steep forehead, high rounded cranial vault, short face and pronounced chin. Being bulky, they were not as tall as Neanderthalers. Structurally the Cromagnon man had a lot of resemblance to modern Europeans. It appears that the stone implements of Cromagnon's man had a high technological perfection. One could obtain in fossils long thin blades of various types.

Further, Cromagnons had a taste for art. They made beads, carved statues and even engraved pictures. The cave paintings made by these men are a record of their aesthetic sense. Their burials were ceremonial and gave an indication of their cultured life. It could be said that with the appearance of Crornagnon, the modern human, the morphological evolution of humans is more or less complete and any further progress is relate8 to culture and language. We shall be looking into the details of this aspect in our next unit. Nevertheless, we briefly outline here some of the important landmarks in the human progress.

A significant shift in the pattern of the human activity has occurred beginning about 10,000 years ago. This shift manifested itself in various aspects of his life. For instance, there was a shift from hunting and gathering to agriculture. There was a shift in the tool making process also. From the paleolithic age which was marked by making stone tools, he began to make his implements first in bronze and then in iron.

And beginning 5,000 years ago special occupations developed, the cities began to be formed and the development of various aspects of culture such as writing, history, wealth, leisure, science and arts took place. This can briefly be the evolution of modern humans.


Related Discussions:- Cromngnon skull

How do you determine if a molecule is polar or non-polar, How do you determ...

How do you determine if a molecule is polar or non-polar? A polar molecule is a molecule that has a net dipole moment because of its having unsymmetrical polar bonds

How public perception of science has distorted, Give an example of how the ...

Give an example of how the public perception of science has been distorted or manipulated to serve an alternative purpose.

Inadequate dietary intake - cause of anaemia is dietary, Define Inadequate ...

Define Inadequate Dietary Intake - cause of anaemia is dietary? The commonest cause of anaemia is dietary inadequacy of iron. The dietary intakes arc usually half of the recomm

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the exercises require to do diabetic patient, Determine the Exerc...

Determine the Exercises require to do diabetic patient Exercises are any bodily activity that enhances or maintain physical fitness and overall health. It is performed for stre

Treatment of heart failure, Over the past decade, the conceptual understand...

Over the past decade, the conceptual understanding of heart failure has changed significantly. Several large clinical trials have demonstrated that non-pharmacological and pharmaco

Carbohydrates, what is the structural formula for Galactose?

what is the structural formula for Galactose?

Explain cell membrane and plasma membrane, Explain cell membrane? The...

Explain cell membrane? The Cell Membrane :  The cell membrane, or plasma membrane, separates the cell from neighboring cells or from the external environment. Both prokaryot

System that permits movement and fixation to echinoderms, What is the syste...

What is the system that permits movement and fixation to echinoderms? The system that allows movement and fixation to substrates in echinoderms is known as the ambulacral syste

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd