Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What determines an individual's Work Capacity or VO 2 Max? Both aerobic and anaerobic mechanisms determine an individual's performance capacity. VO 2 max is determined by the
Domestication - Wildlife It means that man has taken under his direct care the living beings which are useful to him. Through extensive breeding programmes, he has modified th
Endocrine System The nervous system brings about integration and co-ordination of several activities of the animal. The afferent stimuli from several sense organs are brought
Q. Enumerate the anatomic consequences of edentulism? The anatomic consequences of edentulism include the effect of edentulism on bone and soft tissues. Basal bone forms the de
Locust Bean Gum Locust bean gum (also called Carob bean gum) is extracted from the seed (kernels) of the carob tree (Ceratonia siliqua). Structurally, locust bean gum is compos
Define Preparation of Dilutions - Standard or Total Plate Counts? 1. Serial dilution of homogenized sample in an appropriate diluent. Preparation of dilutions - Decimal dilu
Define Some Caution for Inoculating Loops and Needles? 1. Heat the inoculating wire till it becomes red hot. 2. Never use hot inoculating wire for culturing otherwise cells
Mosaic Endosperm - Variants of Endosperm In some plants patches of two different colors appear in the tissues of the endosperm providing a mosaic design. In maize, red and whi
Characteristics of Soil Profile The profile characteristics studied in the field consist of locating the soil hor izons (based on its colour description that includes the col
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd