Coxal glands, Biology

Assignment Help:

Coxal Glands

There is a pair of coxal glands, in almost all the segments in Onychophora (Peripatus). Developmentally; in every segment a hollow follicle or somite arises and in the trunk region, they become divided in dorsal and ventrolateral portions. The ventrolateral portion grows into the appendages and its cavity makes the end sac of the coxal gland. The end sac opens by a ciliated canal, the coelomostome, into acoiled excretory canal. The terminal portion of the canal is enlarged to form a vesicle or bladder. So the coxal glands are derived from coelomoducts. In arthropods there is a likeness in the formation of coxal glands from coelomoducts and the creation of gonads and their ducts.

In crustaceans they are found in third and sixth segments and they are suitably. named depending upon the site of their opening to outside. The one located at the base of the third segment opens at the base of the antenna, therefore called antennal gland. The one located in the sixth segment opens at the base of the second maxilla, and is termed as maxillary gland. Antennal gland is present in the larval forms of Ostracoda, Copepoda, Branchiopoda, Branchiura, Cirripedia and lower Malacostraca but TP the adults of these groups have maxillary glands. The adult amphipod and decapod crustaceans comprise antennal glands. Mysidacea, a primitive group of crustaceans have both of the antennal and maxillary glands functional. Most arachnids have a pair of coxal glands opening in the sixth segment, opening at the base of third pair of walking legs. In Limulus, there are four pairs of coxal glands.


Related Discussions:- Coxal glands

Enhancing the bio-availability of minerals, Mineral supplements and Mineral...

Mineral supplements and Mineral supplements and enhancing the bio-availability of minerals The proper balance of protein, energy, vitamins, and minerals is needed in the ratio

What are cell movements, Cell movements are movements performed by cell str...

Cell movements are movements performed by cell structures, like the movements of cilia and flagella, the pseudopod movements (in amoeba, macrophages, etc.), the cyclosis of the cyt

What are angiosperms, What are angiosperms, the flowering plants? What is t...

What are angiosperms, the flowering plants? What is the major feature that distinguishes them from the gymnosperms? Flowering plants have flowers and seeds (phanerogamic plants

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How many kcal of gross energy were formed, The question asks . . . 18 moles...

The question asks . . . 18 moles of moles of maltose are completely oxidized by the reactions of the final oxidative pathways (Embden-Myerhoff Pathway and Krebs Cycle). How many AT

Sulphur (s) - macronutrients, Sulphur (S) - Macronutrients Sulphur is ...

Sulphur (S) - Macronutrients Sulphur is present in the soil in inorganic and organic forms. In most soils organically bounds is the major S reservoir. The inorganic forms of S

Which is better-scrubbing the instruments or ultrasonic bath, Q. Which is b...

Q. Which is better-scrubbing the instruments or ultrasonic bath to clean the instruments? Ultrasonic bath to clean the instruments is better than hand scrubbing the instruments

Explain about the ph - nutritional biochemistry, Explain about the PH - Nut...

Explain about the PH - Nutritional Biochemistry? You have already studied about pH in your undergraduate years and know what it means. Yes, mathematically we can define pH as e

What is immunopurification, Purifying antigens present in small quantities ...

Purifying antigens present in small quantities as a mixture by relating an antibody to an antigen.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd