Could she ever have a child with blood type o, Biology

Assignment Help:

a) Indicate the blood types possible from the mating of a male who is blood type O with a female of blood type AB. b) Could a female with blood type AB ever produce a child with blood type AB? c) Could she ever have a child with blood type O?


Related Discussions:- Could she ever have a child with blood type o

Organic chemistry and macromolecules, identify 7 speccific ways in which yo...

identify 7 speccific ways in which you can diversify carbon-containing compounds

Illustrate mitosis and define significance of mitosis, Q. What is the mitos...

Q. What is the mitosis? What is the significance of mitosis? Mitosis is the process in which one eukaryotic cell divides into two cells identical to the parent cell generally i

Determine about benefits of jogging, Determine about benefits of Jogging ...

Determine about benefits of Jogging Jogging gives a sense of wellness to a diabetic patient. The frequency of jogging should be at least 3 days in week with a distance of 2 km

Explain the absence of passive fit of the prosthesis, Absence of Passive Fi...

Absence of Passive Fit of the Prosthesis A passive fit of the prosthesis reduces long term stresses in the superstructure, implant components and the bone adjacent to the impla

Bioluminescence, #question.which annelids shws bioluminescence .

#question.which annelids shws bioluminescence .

Find the biosynthesis of acetylcholine, On the overall process of cell-to-c...

On the overall process of cell-to-cell communication within the nervous system, what role does the Ca2+ play in the synapse? A) contributes in the biosynthesis of acetylcholine B)

Protonephridia and metanephridia, Protonephridia and Metanephridia Ne...

Protonephridia and Metanephridia Nephridia take place in two major forms - the protonephridium and metanephridium. Protonephridia are found in flat worms. The protonephridial

Name the element needed to insure the integrity of membranes, In mammalian ...

In mammalian body, this element plays numerous important roles. Try to identify this element with the fewest number of clues. This element is needed to insure the integrity and per

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd