Correction of reversible causes, Biology

Assignment Help:

In the long term reversible causes of heart failure like valvular lesions, myocardial ischemia, uncontrolled hypertension, arrhythmias, alcohol, negative inotropic agents, intracardiac shunts, and high-output states should be identified and corrected.

Some metabolic and infiltrative cardiomyopathies may be partially reversible, or their progression may be slowed; these include hemochromatosis, sarcoidosis, and amyloidosis.

Reversible causes of diastolic dysfunction include pericardial disease and left ventricular hypertrophy due to hypertension.


Related Discussions:- Correction of reversible causes

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the scaling from individuals to ecosystems, Explain the Scaling fro...

Explain the Scaling from individuals to Ecosystems? Models that explain how individual organisms acquire energy and materials, and how they use them for survival, growth and re

Determine the psychological problems, Psychological Problems Failure to...

Psychological Problems Failure to fulfill the patient's expectations and failure to gain the patient's acceptance and satisfaction constitutes a psychological failure. It is hi

Explain the term - seashore rhythm test, Explain the term - Seashore Rhythm...

Explain the term - Seashore Rhythm Test This test consists of 30 pairs of rhythmic patterns. The task is to judge whether the two members of each pair are the same or different

Ram ventilation, Ram Ventilation Some fish do not use pumping action f...

Ram Ventilation Some fish do not use pumping action for gill ventilation. It has been known for long that large tunas cannot be kept alive in captivity unless they are put in

How does the amoeboid movement occur, How does the amoeboid movement occur?...

How does the amoeboid movement occur? What are examples of beings and cells that use such movements for locomotion? Amoeboid movements are formed by cytoplasmic movements and p

Would induction of CYP 2E1 raise your blood alcohol level?, If I take a dru...

If I take a drug that induced the synthesis of CYP 2E1 in my system, would that raise or lower my blood alcohol level after I drink a beer or wine (compared to if I hadn''t taken t

Define the symptoms in blood of pernicious anaemia, Define the Symptoms in ...

Define the Symptoms in Blood of Pernicious Anaemia? Blood: The RBC count is low-1.5-2.5 million per mm 3 (normal range is 4.5- 5.5 million per mm 3 ). The average diameter o

Botany, subject for botany assignment

subject for botany assignment

Explain the donnan membrane equilibrium, Explain the Donnan Membrane Equili...

Explain the Donnan Membrane Equilibrium? If one of the solutions in a two-phase membrane equilibrium contains certain charged solute species that are unable to pass through the

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd