Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Grasping instruments
-Plier or clamp forceps -put piece of rubber in the plier -applied on the buccal and lingual surface -make pressure to break the cemented bond between crown and tooth and be removed easily.
Q. How does the body defend itself from microorganisms and other harmful substances that enter the airway during the breathing process? The epithelium of the airway is a ciliat
Q. List the four objectives of counselling a diabetic patient? Objectives of Diabetes Counselling 1. Facilitating decision to start treatment and change life style 2.
Q. What are the sources of dietary fibre in our diet? The sources of dietary fibre include whole grain cereals, legumes, whole pulses, leafy vegetables, vegetables like peas,
Lymphatic Vessels The function of lymphatic vessels is to aid in the return of interstitial fluid to intra-vascular volume. They assist with transport of lipids from th
what is the basic structure of a virus?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Question 1: (a) Give, in order, the major categories of taxonomic classification. (b) Differentiate between the five kingdoms of organisms. (c) Differentiate between net
Process of Memory: There are three stages of memory Encoding process: It is the process of receiving sensory input and transforming it into a form or code, which can be stored.
excretory organ of lizard
What is the epidemiological association between hemophilia and HIV infection? As hemophilic patients need frequent transfusions of clotting factors (VIII or IX) they are more s
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd