Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The nerve centres which control the body temperature and the urge for eating recontained in: 1. Hypothalamus 2. Pons 3. Cerebellum 4. Thalamus Hypothalamus is the
What is Iris Coloboma Coloboma is a congenital abnormality due to non-fusion of the embryonic choroidal fissure. It can affect any part of the eye and may involve the optic ner
Lipids Lipids are oily or greasy organic compound forming about 3% of protoplasm. These are also compound of carbon hydrogen and oxygen but unlike carbohydrates. The hydrogen a
Q. Is fecundation in amphibians internal or external? In this aspect are amphibians evolutionarily proximal to fishes or to reptiles? In the majority of the amphibian species f
Q. What is ST segment depression at rest? ST- segment depression has become severe, that is, 3 to 4mm or more in vigorous asymptomatic subjects. If the patient is known to have
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the most accepted hypothesis about the origin of life on earth? How does it compare to the other main hypotheses? The heterotrophic hypothesis is the strongest and most
The tertiary protein structure is a spatial conformation additional to the secondary structure in which the alpha helix or the beta-sheet folds up itself. The forces that stay the
What key idea, contained in Malthus's essay on populations, helped Darwin formulates his theory of natural selection?
Describe Pericardial Rub and their Characteristic ? Generation of sound: The sound is generated due to rubbing of visceral and parietal pericardial surfaces against each other
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd