Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Convulsive Disorders
Definition
Convulsion is a series of forceful in voluntary contraction and relaxation of voluntary muscles due to disturbance of brain function. It is also manifested by involuntary, sensory, autonomic or psychic phenomenon and may have alterations or loss of consciousness.
Convulsions are relatively common in infancy and childhood.
1. Carbon monoxide (CO): It is colourless, odourless, tasteless gas and is not soluble in water. Source: CO is produced due to: (i) Incomplete combustion of fuels
A student while studying the anatomy of leaves of four specimens (P - S), observed the following characters: P. Reticulate venation and no bundle sheath. Q. Parallel venati
Physical map is the map of locations of the identifiable landmarks on DNA (for example restriction of the enzyme cutting sites, genes), regardless of their inheritance. Distance i
Define about the Classification of polyphenols? The various classes are: a) Phenolic acids and derivatives b) Flavonoids such as Flavonols and Flavones, Isoflavones and
vulture undergo which type of nutrition
Pigs This is a sub-acute or chronic infection manifested by abortion, sterility, high piglet mortality and orchitis in pigs. Br. suis causes brucellosis among pigs. It is morph
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define the Dietary Guidelines? Dietary Guidelines are becoming increasingly powerful tools to help the general public to appreciate the role of diet in prevention of degenerati
Q. Explain about Spring Model ? The spring model depicts elasticity. A force is applied in terms of load onto the spring as illustrated in the figure 8.6. When the force is app
Define Terpene Alcohols - non glyceride fractions? Partly free, partly esterified e.g. ferulic acid; these are found in significant amounts in rice bran oil, wheal germ oil, so
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd