Convulsive disorders, Biology

Assignment Help:

Convulsive Disorders

Definition

Convulsion is a series of forceful in voluntary contraction and relaxation of voluntary muscles due to disturbance of brain function. It is also manifested by involuntary, sensory, autonomic or psychic phenomenon and may have alterations or loss of consciousness.

Convulsions are relatively common in infancy and childhood.


Related Discussions:- Convulsive disorders

Some common air pollutants: carbon monoxide, 1.   Carbon monoxide (CO): ...

1.   Carbon monoxide (CO): It is colourless, odourless, tasteless gas and is not soluble in water. Source: CO is produced due to: (i)     Incomplete combustion of fuels

Explain anatomy of leaves of four specimens, A student while studying the a...

A student while studying the anatomy of leaves of four specimens (P - S), observed the following characters: P.  Reticulate venation and no bundle sheath. Q. Parallel venati

Physical map, Physical map is the map of locations of the identifiable lan...

Physical map is the map of locations of the identifiable landmarks on DNA (for example restriction of the enzyme cutting sites, genes), regardless of their inheritance. Distance i

Define about the classification of polyphenols, Define about the Classifica...

Define about the Classification of polyphenols?  The various classes are: a) Phenolic acids and derivatives b) Flavonoids such as Flavonols and Flavones, Isoflavones and

Nutrition, vulture undergo which type of nutrition

vulture undergo which type of nutrition

Bacterial diseases-pigs, Pigs This is a sub-acute or chronic infection ...

Pigs This is a sub-acute or chronic infection manifested by abortion, sterility, high piglet mortality and orchitis in pigs. Br. suis causes brucellosis among pigs. It is morph

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define the dietary guidelines, Define the Dietary Guidelines? Dietary G...

Define the Dietary Guidelines? Dietary Guidelines are becoming increasingly powerful tools to help the general public to appreciate the role of diet in prevention of degenerati

Explain about spring model, Q. Explain about Spring Model ? The spring ...

Q. Explain about Spring Model ? The spring model depicts elasticity. A force is applied in terms of load onto the spring as illustrated in the figure 8.6. When the force is app

Define terpene alcohols - non glyceride fractions, Define Terpene Alcohols ...

Define Terpene Alcohols - non glyceride fractions? Partly free, partly esterified e.g. ferulic acid; these are found in significant amounts in rice bran oil, wheal germ oil, so

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd