Composting, Biology

Assignment Help:

Composting

It is a modification of a conventional or solid manure handling system with anaerobic decomposition. Types of composting systems include windrow, bin, static pile and aerated static pile. Composting is primarily an oxidative process which removes many odorous compounds and converts organic solids in to carbon dioxide. This helps in reducing volume and removes volatilized nitrogen. However, the final product is stable and much less odorous than the initial manure.


Related Discussions:- Composting

How do antibody-based tests detect how hiv infection work, Q. How do antibo...

Q. How do antibody-based tests detect how HIV infection works? Subsequent to the infection by the HIV the immune system begins the production of antibodies (primary immune resp

Nervous system of asteroidea, Nervous System of Asteroidea The nervous...

Nervous System of Asteroidea The nervous system of steroids is not ganglionated and is closely related with epidermis. It consists mainly of a circumoral nerve ring surroundin

Chlamydiosis-prevention and control, Prevention and control The organism i...

Prevention and control The organism is sensitive to penicillin, tetracycline and other broad-spectrum antibiotics. Newer generation drugs are being used for the treatment of affec

Show Relation between tissue and the implant material, Relation between Tis...

Relation between Tissue and the implant material The biologic interaction between the tissue and the implant material at an  interface may result in a variety of phenomena such

Explain adverse effects of enfuvirtide, Adverse effects of Enfuvirtide ...

Adverse effects of Enfuvirtide Almost all patients make local injection site reactions to enfuvirtide, usually having of mild or moderate pain, erythema, induration, nodules an

Biosynthesis of amino acids, Microorganisms and Plants can synthesize all o...

Microorganisms and Plants can synthesize all of the 20 standard amino acids. Mammals, furthermore, cannot synthesize all 20 and must obtain some of them in their diet.  Those  amin

Mechanism of fertilization, MECHANIS M OF FERTILIZATION - The process ...

MECHANIS M OF FERTILIZATION - The process of fertilization complete into 5 steps - 1 .      APPROACH OF SPERM TO OVUM For fertilization sperm & ova interaction is

Etiological factors involved in short bowel syndrome, Q. Etiological factor...

Q. Etiological factors involved in short bowel syndrome? The etiological factors involved in this disease are: • Anaemia • Osteoporosis • Stone formation • Decrease

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is light microscope, Question Write a short note on the followin...

Question Write a short note on the following - 1 Plastids 2 Phagocytosis 3 Ribosomal subunits 4 Microfilaments 5 Cell cycle control 6 Tight junctions 7 W

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd