Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Complications during angina pectoris?
It is a symptom giving a warning of impending myocardial infarction, sudden cardiac death or even ischemic necrosis of the brain leading to cerebral stroke.
TEST TUBE BABY - Ova are fertilized in laboratory dish (in vitra) containing a nutrient broth . It may be artificial insemination donor (AID) / Artificial insemination h
Q. How is arthropod reproduction characterized? Reproduction in beings of the phylum Arthropoda is sexual with larval stage in some insects and crustaceans (arachnids) present
MUCOPROTEIN S (GLYCOPROTEINS) Proteins having conjugated mucosaccharides that form viscous mucus or mucoid secretions. The gastric mucus or mucoprotein is resistant to p
CELL WALL Discovered by Robert Hooke , 1665 when he saw dead empty cork cells. Bonne r - studied the chemical nature of cell wall. The cell wall is a rigid & prote
What is Smooth Muscle? Smooth muscle provides the contractile force for movement in internal organs under control of the involuntary or autonomic nervous system. Smooth muscle
P HYSICA L PROPERTIES OF PROTOPLASM - 1 . Phase reversal - Due to difference in temperature outer part is gel and inner part of sol 2. Tyndall effect - Be
How do you convert 147.05mg% of plasma glucose to mM/L please show work.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Carbohydrate Metabolism of manganese? Mn is required for carbohydrate metabolism. Enzymes pyruvate carboxylase and phosphoenol pyruvate carboxy kinase involved in glucon
classification of protozoa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd