commensalism, Biology

Assignment Help:
#quesWhat benefits can commensalism offer to a species..

Related Discussions:- commensalism

What is anemia, What is anemia? What are the four main types of anemia? ...

What is anemia? What are the four main types of anemia? Anemia is low concentration of hemoglobin in the blood. The four main types of anemia are the nutrient-deficiency ane

What are the main cells of which poriferans are made, What are the main cel...

What are the main cells of which poriferans are made? Sponges have their outer wall covered by flat cells known as pinacocytes and having pores well-delimited by special cells

Sporotrichosis, Sporotrichosis Sporotrichosis is subacute or chronic i...

Sporotrichosis Sporotrichosis is subacute or chronic infectious disease caused by a dimorphic fungus, Sporothrix schenkii which occurs commonly in soil, wood and vegetation. T

Why to dilute this stock to give the desired concentration, You are working...

You are working on a protocol in lab that requires 10ml of a 5% saline solution for a particular step. All you have in your lab is a 20% saline stock solution. How can you dilute t

Respiration, #question.what are the organs of respiration in the lwer form ...

#question.what are the organs of respiration in the lwer form of animals .

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Can you explain about cardiomyopathies, Q. Can you explain about Cardiomyop...

Q. Can you explain about Cardiomyopathies? Cardiomyopathy is a primary disorder of heart muscle that may cause cardiac dysfunction and is not related to any obvious disease pr

Microorganisms acquired during transport of raw food, Microorganisms Acquir...

Microorganisms Acquired During Transport, Handling and Processing of Raw Foods Microorganisms can come from truck, tanker, food handlers and equipment and utensils used in the

Hazardous material - factors affecting occupational health, Hazardous Mater...

Hazardous Material - Factors Affecting Occupational Health Handling and storage of flammable and combustible liquids all the time pose threat to occupational safety. Fire and

Cnidaria - protozoa, Cnidaria - Protozoa The mature medusoid jellyfish...

Cnidaria - Protozoa The mature medusoid jellyfishes like Aurelia are the sexual stages. Sperms and eggs produced in the dissimilar (male and female) individuals ale released i

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd