Coagulation - blood collection , Biology

Assignment Help:

Coagulation - Blood Collection:

Plasma is used to minimize the time needed for coagulation so it is used is medical emergencies.

There are many types of anticoagulants used nowadays for example:

  • Heparin (salt of mucoitin polysulforic acid) is widely used and causes the least interference with the tests. About 20 units of heparin is needed to anticoagulate 1 ml of blood.
  • Ethylenediaminetetraacitic acid (EDTA): this chelating agent is presented as salt with final effective concentration of 1-2 mg/ml of blood. It should not be used for specimens tested for calcium analysis.
  • Sodium fluoride: this is generally considered as a preservative of glucose (it inhibit enzyme system involved in glycolysis); however it has weak anticoagulant activity. Fluoride at a concentration of about 2 mg/ml is the best preservative for glucose. Most specimens are preserved at 25 oC for 24 hr or 4 oC for 48 hr. Urea can not be estimated (in urease based methods) in a sample with fluoride because it inhibit the enzyme urease.
  • Other anticoagulants used are for example sodium citrate, oxalates, and iodoacetate.

          For estimation of bicarbonate in blood, it should be collected under one inch column of liquid paraffin to avoid exposure to the atmosphere, before it is centrifuged and processed. This is to avoid escape of carbon dioxide.

 

 


Related Discussions:- Coagulation - blood collection

Brain region that triggers the voluntary motor activity, Which is the brain...

Which is the brain region that receives conscious sensory information? Which is the brain region that triggers the voluntary motor activity? In the brain conscious sensory info

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Eggs, What is the type of egg in which yolk is absent?

What is the type of egg in which yolk is absent?

Explain about climate regulation, Q. Explain about Climate Regulation? ...

Q. Explain about Climate Regulation? By giving off moisture through their leaves and providing shade, plants help keep us and other animals cool. Forests are especially good cl

Explain micropener - non-surgical endodontic retreatment, Explain Micropene...

Explain Micropener - Non-surgical Endodontic Retreatment        They are iso-colour coded flexible, StSt hand instruments It has with 7mm k-type flutes, It is ava

Intron, The introns are the portions of genomic DNA which are transcribed (...

The introns are the portions of genomic DNA which are transcribed (and hence present in the primary transcript) but are then spliced out later. They therefore are not present in th

Proteins of animal origin - shell fish, Proteins of Animal Origin - Shell F...

Proteins of Animal Origin - Shell Fish Shell Fish: Information on shellfish is fragmentary and incomplete. In shell fish, the shell comprises of a large portion of live weight

Effect in controlling communicable disease, Early campaigns of the 19th cen...

Early campaigns of the 19th century that focused on sanitation, hygiene, housing, and nutrition had little effect in controlling communicable disease due to flawed rationale based

Sunshine recorder, Sunshine recorder Sunshine recorder (Figure shown be...

Sunshine recorder Sunshine recorder (Figure shown below) measures the duration of sunshine. The recorder consists essentially of a glass sphere of about 10 cm in diameter mount

Specify the term in detail - swim bladder, Specify the term in detail - Swi...

Specify the term in detail - Swim bladder. Found in bony fish, this gas-filled chamber is used to main neutral buoyancy. Oxygen in blood is added or removed as required. Swim b

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd