Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Coagulation - Blood Collection:
Plasma is used to minimize the time needed for coagulation so it is used is medical emergencies.
There are many types of anticoagulants used nowadays for example:
For estimation of bicarbonate in blood, it should be collected under one inch column of liquid paraffin to avoid exposure to the atmosphere, before it is centrifuged and processed. This is to avoid escape of carbon dioxide.
Which is the brain region that receives conscious sensory information? Which is the brain region that triggers the voluntary motor activity? In the brain conscious sensory info
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the type of egg in which yolk is absent?
Q. Explain about Climate Regulation? By giving off moisture through their leaves and providing shade, plants help keep us and other animals cool. Forests are especially good cl
Explain Micropener - Non-surgical Endodontic Retreatment They are iso-colour coded flexible, StSt hand instruments It has with 7mm k-type flutes, It is ava
The introns are the portions of genomic DNA which are transcribed (and hence present in the primary transcript) but are then spliced out later. They therefore are not present in th
Proteins of Animal Origin - Shell Fish Shell Fish: Information on shellfish is fragmentary and incomplete. In shell fish, the shell comprises of a large portion of live weight
Early campaigns of the 19th century that focused on sanitation, hygiene, housing, and nutrition had little effect in controlling communicable disease due to flawed rationale based
Sunshine recorder Sunshine recorder (Figure shown below) measures the duration of sunshine. The recorder consists essentially of a glass sphere of about 10 cm in diameter mount
Specify the term in detail - Swim bladder. Found in bony fish, this gas-filled chamber is used to main neutral buoyancy. Oxygen in blood is added or removed as required. Swim b
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd