Cnidarla, Biology

Assignment Help:

Tlie phylum Cnidaria or Coelenterata, includes the faliiiliar hydras, jelly fishes, sea anemones and corals. You have olreacly studied about Cnidarialis in Units 4 and 7 of LSE-09 course. These are often brilliantly colourcd. They exhibit radial symnietry, The Cnidarians possess two basic metazoall structural features. Onc, there is an intenla1 space for digestion, called in Cnidarinns as gastrovascular cavity. This cavity lies along the polar axis of the animal atid opens to tlie outside at one end to for111 noutli, Tlie presence of a mouth a~id digestive cavity permits the use of a mucll greater rnlige of food sizes than is possible in tlie protozoarls and sponges. Two, in Clidariails a circle of tentacles, representing exte~lsiolls of the body wall, surrounds tlie ~lioiltli to aid in tlie capture and ingestion of food. Tlie Cnidarian body wall consists of three basic layers: an outer lnycr of cpidennis, nn inner layer of elidoder~nal cells lining Ilie gastrovnscilar cavity, and between these two a layer called mesoglea. The rnesoglea ranges from n tliin, non cellilar membranc to a thick, fibrous, jelly-like, coid lnaterial with or without wanderillg a~noebocytes, A considerable number of different cell types compose tlie epidermis and gastrader~nis, but there is only a limited degree of organ development.


Related Discussions:- Cnidarla

How poor selection of food causing the underweight, How Poor Selection of F...

How Poor Selection of Food causing the Underweight? Poor Selection of Food: Poor selection of food along with irregular eating habits may be responsible for insufficient food

Define importance of nutrition in human body, Define Importance of Nutritio...

Define Importance of Nutrition in Human Body? Nutrition is increasingly being recognized as an important determinant, which modulates the biological process of ageing. Poor nut

Are body planes important for identifying structure, Q. Are body planes imp...

Q. Are body planes important for identifying anatomical structure? In order to observe and study structural arrangement of the internal organs, body may be divided and sectione

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the indications of implant removal, What are the indications of im...

What are the indications of implant removal? Failed implants need to be removed and the specific indications include: - Severe Perimplant bone loss (> 50 per cent implant le

Biota of littoral zone, Biota of Littoral Zone This zone is the shore ...

Biota of Littoral Zone This zone is the shore region of the marine ecosystems and is subject to violence of waves and tides, fluctuation of water level and variability of temp

Results of cabg , Results of CABG: In most centres where this operation ...

Results of CABG: In most centres where this operation is routinely conducted the mortality is 1-2 per cent. In high-risk group of patients this may go up to 5 to 10 per cent.

What are the main human diseases caused by fungi, What are the main human d...

What are the main human diseases caused by fungi? The main human diseases caused by fungi are coccidioidomycosis, histoplasmosis, blastomycosis, paracoccidioidomycosis, or Sout

Explain changes in feeding behaviour of infants, Explain Changes in feeding...

Explain Changes in feeding behaviour of infants? On maturation of neuro-muscular system, the body is able to coordinate sucking, swallowing and breathing. Till about three mont

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd