clonning, Biology

Assignment Help:
write a note on clonning

Related Discussions:- clonning

What are venous vessels, Q. What are venous vessels, venules and veins? ...

Q. What are venous vessels, venules and veins? Venous vessels are every blood vessel that carries blood from the tissues to the Venules, Veins and heart are venous vessels. Ven

How do birds reproduce, Q. How do birds reproduce? Birds like every ver...

Q. How do birds reproduce? Birds like every vertebrate have sexual reproduction. Their embryos develop within shelled eggs containing extraembryonic membranes and exterior the

Depth and currents, Depth and Currents Depth The sea is v...

Depth and Currents Depth The sea is very deep varying in different regions. Generally life extends to all depths but is confined more to the continental shelf and

Role of private sector in health care - competition, Role of Private Sector...

Role of Private Sector in Health Care - Competition When the private sector is driven by competition it tends to be more efficient. With competition, benefits like cost reduct

Retention of soil moisture, Retention of Soil Moisture The movement of ...

Retention of Soil Moisture The movement of water into and within the soil, moisture storing capacity of soils and the availability of moisture to plants are governed by soil pr

Describe the process of rodent control, Q. Describe the process of Rodent c...

Q. Describe the process of Rodent control? Rats and mice are destructive and cause huge loss of stored food commodities. They transmit pathogenic bacteria. Rats and mice are ge

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain both food and light as zeitgebers, Must account for both food AND l...

Must account for both food AND light as zeitgebers Because of the continuous light / dark periods of the year; light not always able to act as a zeitgeber. Food

Illustrate mitral valve orifice area, Q. Illustrate Mitral Valve Orifice Ar...

Q. Illustrate Mitral Valve Orifice Area? The normal mitral valve orifice in an adult is 4-5cm 2 when the valve is completely open in diastole. When the mitral valve orifice ar

Describe circulatory system, Circulatory system:  One of the eleven major b...

Circulatory system:  One of the eleven major body organ systems in animals; carbon dioxide, nutrients, transports oxygen, and waste products between the cells and the respiratory s

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd