Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
In earthworms, when the ovaries mature, the clitellum secretes a viscous substance in the form of a girdle. This girdle hardens in to a cocoon around the clitellum. The ova are dis
Define Carbohydrate requirement to avoid underweight problem? Liberal amounts of easy to digest carbohydrates should be included in the diet. The intake of dietary fibre should
To study the conditions essential for the germination of seeds:- In the diagram below a having seeds on cotton wool with air, warmth, but no water; b has water, warmth, but no
Q. What is the kind of circulatory system present in arthropods? Do these animals have respiratory pigments and heart? In arthropods the respiratory system is open (lacunar). B
Define Causes of Vitamin A Deficiency - Inadequate diet? A child is born with poor stores of vitamins and minerals due to maternal malnutrition. Diets of pregnant women are def
Part of the endocrine system in humans, these 2 glands are small bodies located at upper end of every kidney. While these glands perform a range of functions, two of the most signi
Which of the following statements concerning the inheritance of a dominant trait is true? Every affected person must have at least one affected parent. The trait is observed to ski
learn allchapter
Define Determinants of Food Security - Food Access? Food access is linked to its affordability. Food access is ensured when households and all individuals within them have adeq
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd