Cloning protocol, Biology

Assignment Help:

1945_Alkaline Phosphate treatment.png

Sally Subcloner wants to clone a fragment into pUC19 (Map above - From New England Biolabs). Her fragment was a protein coding gene of 2.7 kb, and had XhoI sites on either end (and no other XhoI sites any where else) and she agarose gel purified this fragment to ensure it was pure. As no XhoI sites existed in the pUC19 plasmid, she decided to clone it into the Sal1 site, as Sal1 and Xho1 have identical overhangs of 5'-TCGA-3' and therefore she believes that they can be ligated to one another. As she was using blue/white screening she did not bother with Alkaline Phosphate treatment and ligated the XhoI fragment directly with SalI digested pUC19. After transformation into E. coli (strain AG1 using heat shock treatment) she plated cells onto media with Ampicillin selection (100 mg/mL) and obtained over 300 ampicillin resistant colonies. However none of these were white colonies, only blue, which she interpreted as obtaining no plasmids with the fragment she was aiming to subclone.

(a) Was her cloning approach valid and what was the reason that she could not get white colonies from this protocol? If she modifies the protocol to address this question, what additional advice can you give Sally Subcloner to increase her chances of obtaining white colonies.

(b) After taking this advice and obtaining white colonies, she purified the plasmid from five different white colonies digested them with Xho1 and ran them on a gel (see below). However there were three bands in each lane, with the major band running at approximately 4.5 kb, instead of 2.7 kb that she expected her XhoI fragment to be. Could these plasmids still be the right recombinant and what simple experiment could she perform to determine this? (Hint what control should have been included in the gel?)


Related Discussions:- Cloning protocol

Define types of indicators, Define Types of Indicators? Macro indicator...

Define Types of Indicators? Macro indicators are used at strategic levels while micro indicators are used at performance levels. From the previous sections it is clear that man

How are a hypothesis and an experiment related, How are a hypothesis, a pre...

How are a hypothesis, a prediction, and an experiment related? A prediction is a statement made in advance that declares the results that will be get from testing a hypothesis

What is r - wave amplitude, Q. What is R - Wave Amplitude? The R-wave a...

Q. What is R - Wave Amplitude? The R-wave amplitude in the lateral precordial leads usually decreases more in normal than in abnormal subjects and correlates with left ventr

Which type of defense cell do bacteria attract, Which type of defense cell ...

Which type of defense cell do bacteria attract and cause to multiply during the inflammation process? What is the name given to the waste material produced by the inflammation trig

Mitosis, What are the steps of mitosis in order?

What are the steps of mitosis in order?

Evolutionary implications of natural regulation, Evolutionary Implications ...

Evolutionary Implications of Natural Regulation Many changes in abundance can be attributed to changes in extrinsic factors such as weather, disease or predation. But some cha

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

State the degeneracy of the genetic code, Which of the following contribute...

Which of the following contributes to the degeneracy of the genetic code? A. The presence of 64 codons but only 20 amino acids. B. The ability of a single tRNA to bind to ma

Off pump surgery , OFF PUMP SURGERY :  In spite of great advancements in t...

OFF PUMP SURGERY :  In spite of great advancements in techniques of cardio pulmonary bypass, it is still not physiological. There can be various complications related to perfusion

Endoplasmic reticulum, ENDOPLASMIC RETICULUM (ER) Eucaryotic celIs have t...

ENDOPLASMIC RETICULUM (ER) Eucaryotic celIs have two major compartments- nucleus and cytoplasm. Cytoplasm was known to have no structure until the discovery of electron micrsscop

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd