Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Clonal Propagation
Most cultivars of ornamental and fruit species and forest trees are highly heterozygous. Consequently, their seed progeny is not true-to-type. To preserve the unique characters of selected cultivars of horticultural plants nurserymen practice vegetative propagation, using stem, leaf or root cuttings or propagules such as tubers, corms, bulbs or bulbils. For plants which do not set seeds, such as edible bananas, grapes, citrus, petunia, rose and chrysanthemum, vegetative propagation is the only means of multiplication. A population of plants derived from a single individual by vegetative propagation is genetically uniform and is called a clone. The conventional methods of clonal propagation are slow and often not applicable. For example, the only in-vivo method for clonal multiplication of cultivated orchids, which are complex hybrids is "back-bulb" propagation. It involves separating the oldest pseudobulbil to force the development of dormant buds.
Conformational Protection - Azotobacter In conformational protection a Fe-S redox protein provides protection to the enzyme. The protein gets oxidised in the presence of oxyge
Determine the Human Energy Requirements? This unit focuses on the human energy requirements. The nutrient requirement for Indian population, you may recall studying in the last
the appendages of arthropods; a. may serve as walking legs, b. may be modified into atennae, c. may be modified into large pincers, or d. all of the above
Ultrasonography: Ultrasounds are sound waves with a frequency of higher than the upper range of human hearing i.e., approximately 20,000 cycles per second (20 kilohertz).
If NAD+ is an electron acceptor that becomes NADH and the NADH then donates a proton to ATPase, shouldn't NADH now become NAD- since it lost it's proton but still has the electron?
Genomic blot is the type of Southern blot particularly used to analyze the mixture of DNA fragments derived from total genomic DNA. Because the genomic DNA is quite complicated, w
conclusion on dna replication
Q. From the zygote, pluricellular organisms are formed by serial mitosis. Would this formation be possible if each cell made by mitosis had an identical life in relation to its ant
Compare and contrast covalent and ionic bonds in molecules, give an example of each.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd