Clinical features of aortic stenosis, Biology

Assignment Help:

Q. Clinical Features of aortic stenosis?

Patients with congenital aortic stenosis usually present in childhood or adolescence. Those with rheumatic heart disease present during 30-50 years and with bicuspid valve between 40-60 years. Degenerative aortic valve disease patients present late in elderly age group. There is no direct correlationship with severity of disease and presence or absence of symptoms. However, those with mean transaortic gradient of more than 60 mmHg are often symptomatic. Symptoms include dizziness or syncope, angina and those of heart failure. Dizziness or syncope may be due to arrhythmias or LV dysfunction but more often due to inappropriate baroreceptor function that results in vasodilatation in the presence of fixed cardiac output.

Angina is noted in approximately 50-60 per cent of patients and in about 50 per cent of these patients it is due to associated CAD. Onset of heart failure symptoms usually portends poor prognosis. The life span is usually considered to be 5, 3 and 2 years after the onset of symptoms of angina, heart failure and syncope respectively.

While infective endocarditis may affect non calcified valves, it is uncommon to affect calcific valves. However, micro emboli from calcific valves may occur. Lower G.I. bleeding due to angiodysplasia of ascending colon is a known association of severe valvular aortic stenosis.


Related Discussions:- Clinical features of aortic stenosis

Explain water as a lubricant, Explain Water as a lubricant? All fluids...

Explain Water as a lubricant? All fluids have lubricating as they can make it easier for the solid materials to slip over one another. Water-based fluids act as lubricants in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is tetralogy of fallot, What is Tetralogy of Fallot ? Figure...

What is Tetralogy of Fallot ? Figure: Anatomical location of tetralogy of fallot Indications for Surgery :  The diagnosis of tetralogy is considered as an indicatio

Therapeutic diets - qualitative methods, Therapeutic diets - Qualitative me...

Therapeutic diets - Qualitative methods Qualitative methods: This  is where  you  give  the individual choices,  clear guidelines, menu guidance and supporting  information  su

EMBRYOLOGY., WHAT ARE THE TYPES OF EGG ON THE BASIS OF YOLK ?

WHAT ARE THE TYPES OF EGG ON THE BASIS OF YOLK ?

Aeolian-transported soil, Aeolian Wind transported materials constitute...

Aeolian Wind transported materials constitute this category. This can be further divided into dunes or loess. Dunes are found in thr& types of situations. Fitly, these may occu

How mathematics and statistics related to biology, How mathematics and stat...

How mathematics and statistics related to Biology? This report emphasizes the benefits that the fields of mathematics and statistics can bring to biology, but there are recipro

Genetics, Ask question importance of genetics in human life #Minimum 100 w...

Ask question importance of genetics in human life #Minimum 100 words accepted#

Explain chemically defined or synthetic media-culture media, Explain Chemic...

Explain Chemically Defined or Synthetic Media - Culture Media? Synthetic media are those media where detailed composition of the medium is known in terms of the chemical nature

What are the inferior trophic levels, Can the amount of available energy in...

Can the amount of available energy in a given trophic level be larger than the available energy in inferior trophic levels? What does that condition means to the conformation of th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd