Cleavage and gastrulation, Biology

Assignment Help:

Cleavage and Gastrulation

Eventually, one spermatozoon fuses with the ovum to r restore the diploid genomic condition and activates all the potentials in the fertilized egg cell or zygote to develop into a new individual of the next generation. But the zygote is one cell and the adult body in the Metazoa is constituted of many cells - from a few hundred to many billions of cells. It implies that the unicellular zygote must enter the phase of rapid divisions in quick succession to convert itself into a multicellular body.

Such a series of divisions of the zygote is known as cleavage or segmentation. In this multicellular structure formed as a result of cleavage the various cells or cell groups later become rearranged as layers and sub layers during a process called gastrulation. Cleavage and gastrulation are significant phases in the ontogenetic development because cleavage transforms the unicellular zygote into a multicellular body and gastrulation lays the foundation of primary organ rudiments so as to initiate the formation of organs according to the body plan of the particular metazoan group of animals to which the particular individual belongs.


Related Discussions:- Cleavage and gastrulation

Explain about the waist to hip ratio (whr), Explain about the Waist to Hip ...

Explain about the Waist to Hip Ratio (WHR)? Two individuals who have the same BMI and the same total body fat may have different abdominal fat mass. Abdominal fat accumulation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Can you explain embryonic sac, Q. What is embryonic sac? Which are the cell...

Q. What is embryonic sac? Which are the cells that form the embryonic sac? What are their ploidies? The embryonic sac is female gametophyte of angiosperms. The embryonic sac

What is the energy source used in active transport, What is the energy sour...

What is the energy source used in active transport through biological membranes? The energy essential for active transport (against the concentration gradient of the transporte

Chemoreceptors, Chemoreceptors These are receptors included in percept...

Chemoreceptors These are receptors included in perception of chemical stimuli. You will see that there are three kinds of Chemoreceptors among metazoans:  i) Those concerne

Which does not contain a guanidinium group, Which of the following does NOT...

Which of the following does NOT contain a guanidinium group Select one: a. Urea b. arginine c. creatine d. guanidinium ion

Epiboly - mechanism of gastrulation, EPIBOLY - The epibolic movement...

EPIBOLY - The epibolic movements occur only in the prospective ectodermal blastomeres. In the blastula of frog, migration and rearrangement of microceres over megameres i

Human chromosomes, HUMA N CHROMOSOMES The normal diploid (2N) chromoso...

HUMA N CHROMOSOMES The normal diploid (2N) chromosome number in human being is 46. It was given by T.H. Tjio and A. Levan in 1956. The chromosome complement of a cel

What is the critical photoperiod, What is the critical photoperiod? How can...

What is the critical photoperiod? How can the critical photoperiod relate to flowering be experimentally determined? The critical photoperiod is the limit of the photoperiod du

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd