Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cleavage and Gastrulation
Eventually, one spermatozoon fuses with the ovum to r restore the diploid genomic condition and activates all the potentials in the fertilized egg cell or zygote to develop into a new individual of the next generation. But the zygote is one cell and the adult body in the Metazoa is constituted of many cells - from a few hundred to many billions of cells. It implies that the unicellular zygote must enter the phase of rapid divisions in quick succession to convert itself into a multicellular body.
Such a series of divisions of the zygote is known as cleavage or segmentation. In this multicellular structure formed as a result of cleavage the various cells or cell groups later become rearranged as layers and sub layers during a process called gastrulation. Cleavage and gastrulation are significant phases in the ontogenetic development because cleavage transforms the unicellular zygote into a multicellular body and gastrulation lays the foundation of primary organ rudiments so as to initiate the formation of organs according to the body plan of the particular metazoan group of animals to which the particular individual belongs.
Explain about the Waist to Hip Ratio (WHR)? Two individuals who have the same BMI and the same total body fat may have different abdominal fat mass. Abdominal fat accumulation
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is embryonic sac? Which are the cells that form the embryonic sac? What are their ploidies? The embryonic sac is female gametophyte of angiosperms. The embryonic sac
What is the energy source used in active transport through biological membranes? The energy essential for active transport (against the concentration gradient of the transporte
Chemoreceptors These are receptors included in perception of chemical stimuli. You will see that there are three kinds of Chemoreceptors among metazoans: i) Those concerne
Which of the following does NOT contain a guanidinium group Select one: a. Urea b. arginine c. creatine d. guanidinium ion
EPIBOLY - The epibolic movements occur only in the prospective ectodermal blastomeres. In the blastula of frog, migration and rearrangement of microceres over megameres i
HUMA N CHROMOSOMES The normal diploid (2N) chromosome number in human being is 46. It was given by T.H. Tjio and A. Levan in 1956. The chromosome complement of a cel
What is the critical photoperiod? How can the critical photoperiod relate to flowering be experimentally determined? The critical photoperiod is the limit of the photoperiod du
history of zoology
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd