Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Cleaning efficiency of Detergents and Soaps?
Soaps and detergents emulsify fats, oils and grease so that they are easily washed away. They usually contain chemical builders to enhance their cleaning efficiency. Soap is an oldest and best cleaning compound used but it forms an insoluble curd with hard water, hence not preferred. Instead, detergents are used.
A detergent is a substance which assists in cleaning when added to water. These are normally sodium salts of fatty acids. To be effective, a detergent must have a good wetting capacity and the ability to remove soil from surfaces and carry away residues. Soaps and detergents for household cleaning have a pH of 8.0 to 9.5.
In studies of human body, which of the below terms is used to describe the first step in production of urine? Is it: a) Tubular reabsorption b) Tubular secretion c) Glome
Phanerophytes - Classes of Life Form The perennating buds in this case are present on erect, negatively geotropic shoots, much above the ground. These buds are naked or least
How Surgical technique affect Osseointegration The osteotomy preparation is critical both from biologic and biomechanical points of view. The bone drilling should be sequential
Why can it be said that a recessive allele can remain hidden in the phenotype of an individual and revealed only when manifested in homozygosity in the offspring? A recessive a
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How Infections and Infestations cause PEM? Childhood infections (viral/bacterial) and parasitic infestations are almost always associated with PEM. These cause anorexia (loss o
How many ATP molecules are produced for each glucose molecule used in fermentation? How many ATP molecules are produced for each glucose molecule used in aerobic respiration? I
Colibacillosis of newborn animals This is the commonest disease entity of newborn farm animals. In calves the disease occurs in three forms, viz. enteric colibacillosis manif
Explain what is Enzymes? Enzymes are organic substances that speed up, or catalyze, a chemical reaction. At a given temperature, molecules have varying amounts of energy, and
Q. What is the difference between simple closed circulation and double closed circulation? Double closed circulation or Closed circulation is that in which the blood circulates
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd