Classification of environmental disasters, Biology

Assignment Help:

The Environmental Disasters Are Classified Into Two Major Categories:

1.      Natural Disasters like Earthquakes, Tsunami, Landslides, Cyclones, Floods, and Droughts Etc.

2.      Man-Made Disasters like Nuclear, Biological, Chemical Disasters and Wars Etc.

 

 


Related Discussions:- Classification of environmental disasters

Which substance does not contain hormones , Hormones are composed from seve...

Hormones are composed from several classes of molecules. As far as our present knowledge extends, hormones are not found in which of the subsequent categories of substances: a)

Explain the solubility in water of dietary fibre, Explain the Solubility in...

Explain the Solubility in Water of dietary fibre? Fibres that dissolve in hot water are soluble and those that do not, are insoluble. Several structural features affect solubil

What is a pigment, What is a pigment?  Scientifically, a chemical that ...

What is a pigment?  Scientifically, a chemical that can impart colour and is insoluble in the solvent in which it is used, is referred to as a 'pigment'. Well, you would agree

Dietary management for short bowel syndrome, Q. Dietary Management for shor...

Q. Dietary Management for short bowel syndrome? It must be evident from the symptoms listed above that the disease results in reduced food intake, impaired absorption and hence

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Speculate why stoma in the lower epidermis, Carbon dioxide needed for photo...

Carbon dioxide needed for photosynthesis enters the leaf via the stomata but water is also lost when these pores are open. Water is often limiting and to limit water loss through s

Theory of embryology - theory of epigenesis, THEOR Y OF EPIGENESIS - ...

THEOR Y OF EPIGENESIS - It was propounded by C. F. Wolff and supported by Von Baer. According to it, the egg contains the substances which are required in the formation

What characteristics of fatty acids are false, What characteristics of fatt...

What characteristics of fatty acids are false? (Dissolves in water, used for energy storage, used to build lipids, found in triglycerides, found in steroids)?

Describe about cardiomyopathy due to persistent tachycardia, Q. Describe ab...

Q. Describe about Cardiomyopathy due to Persistent Tachycardia? In occasional cases, particularly in children recurrent or incessant episodes of supraventricular or ventricular

What is lamarckism, What is lamarckism? Lamarckism is the theory that u...

What is lamarckism? Lamarckism is the theory that unites the law of use and disuse with the law of the transmission of acquired characteristics, i.e., that asserted that acquir

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd