Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Ciliary and Flagellar Movements
Cilia and flagella or their derivatives occur in all animal phyla. They constitute the primary locomotor y structures of many protozoa and of several kinds of metazoan cells, for example, sperm, ciliated epithelia of invertebrates and vertebrates. Derivatives of cilia occur in a wide variety of photoreceptor, mechanoreceptor and chemoreceptor cells.
Figure: Ciliary and Flagellar Movements
Cilia and flagella have a similar internal structure; the difference lies in their beating patterns which are illustrated in Figure. A flagellum like a tail of sperm, beats with a symmetrical undulation that is propagated as a wave along the flagellum. A cilium, in contrast beats asymmetrically with a fast or dash-like stroke in one direction, followed by a slower recovery motion in which the bending cilium returns to the original position. In flagellar motion, water is propelled parallel to the long axis of the flagellum; in ciliary motion water is propelled parallel to the surface that bears the cilia.
economic importance of mollusca
Body systems and organs and their functions The human body is a large structural unit made up of many smaller parts. There are four kinds of smaller units - cells, tissues, org
Compare the modes of intercellular communication used by the endocrine and nervous systems and discuss the functional significance of the differences between the two systems.
Which are the germ layers present in cnidarians? Which tissues of the animal do they originate? These beings there ectoderm and endoderm, two germ layers. Animals with only two
GAS T RUL A TIO N - Morphogenic movements are occured. 3 germinal layers are formed. Ectoderm, endoderm & mesoderm. Endoderm is formed first. Mesoderm is formed in the
Use of Spectinomycin in Pregnancy Spectinomycin (Trobicin) can be used to treat pregnant women allergic to beta-lactam antibiotics, but is unreliable against pharyngeal gonoco
Pr o d u c t i o n Diseases The production diseases, which were previously referred as metabolic diseases, include diseases like parturient paresis (milk fever), downer
Q. What are the main chemical compounds that destroy the ozone layer? The major chemical compounds that destroy the ozone layer are the CFCs, chlorofluorocarbons, or freons, su
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Filaments of a sarcomere in a skeletal muscle When the overlap between the thin and thick filaments of a sarcomere in a skeletal muscle is decreasing, A. The total lengt
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd