Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Chronic Bronchitis
Chronic Bronchitis is defined clinically as hypersecretion of mucus and recurrent episode of productive cough for a period of 3 months per year at least two consecutive years.
Pathophysiology
First there is glandular hypertrophy. Mucous gland hypertrophy and hyperplasia from chronic irritations cause excessive mucus production. The excessive mucus and impaired ciliary movement associated with chronic bronchitis increase susceptibility to infection. As infection progress, the epithelial cells produce a mucopurulent exudates in the lumen or the disease may progress to ulceration and destruction of the bronchial wall. The peribronchial fibrosis and the presence of granulation tissue result in stenosis and airway obstruction.
Second the bronchial wall tissue changes, mucosal ocdema and excessive mucus production, all increase airway resistance in persons with chronic bronchitis. Excess mucus may also cause bronchospasm.
Third the pathophysiologic changes may impair the ability of lungs to exchange 0, and CO, leading to ventilation-perfusion mismatching at the alveolar-capillary membrane. Obstructed airways may lead to atelectasis which further diminishes the surface are a available for respiration. Fourth the right ventricular decompensation or corpulmonale may result.
Can you complete this in 24hrs
what is ribosomes
Describe the concept of gastrulation? During embryological development this stage results in blastulas conversion into a gastrula. Cells migrate toward the inside of embryo fro
Assessment of Development in Children The development of a child is studied through various responses which he exhibits following a natural or experimental stimulus. Basical
Myeloid immunodeficiency causes phagocytic function, which is impaired. Those who are affected with this will undergo with enhance in susceptibility to bacterial infection.
Person Z swallowed a large amount of substance X and, as a result, has convulsions (abnormal violent contractions of skeletal muscles). Swallowing which of the following substance
Advantages and Disadvantages: of Organizational Charts Advantages a) Defining the Organizational Relationship Without a,chart, many people might view the organization as
what is the classification of poisonous arthropods according to their mode of toxicity to human
Q. Causes of Diabetic Ketoacidosis? The causes of Diabetic Ketoacidosis (DKA) are the following: - Missing of insulin injection - Infection - Trauma (injury) - Myoc
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd