Chronic bronchitis, Biology

Assignment Help:

Chronic Bronchitis

Chronic Bronchitis is defined clinically as hypersecretion of mucus and recurrent episode of productive cough for a period of 3 months per year at least two consecutive years. 

Pathophysiology

First there is glandular hypertrophy. Mucous gland hypertrophy and hyperplasia from chronic irritations cause excessive mucus production. The excessive mucus and impaired ciliary movement associated with chronic bronchitis increase susceptibility to infection. As infection progress, the epithelial cells produce a mucopurulent exudates in the lumen or the disease may progress to ulceration and destruction of the bronchial wall. The peribronchial fibrosis and the presence of granulation tissue result in stenosis and airway obstruction.

Second the bronchial wall tissue changes, mucosal ocdema and excessive mucus production, all increase airway resistance in persons with chronic bronchitis. Excess mucus may also cause bronchospasm. 

Third the pathophysiologic changes may impair the ability of lungs to exchange 0, and CO, leading to ventilation-perfusion mismatching at the alveolar-capillary membrane. Obstructed airways may lead to atelectasis which further diminishes the surface are a available for respiration. Fourth the right ventricular decompensation or corpulmonale may result.


Related Discussions:- Chronic bronchitis

Describe the concept of gastrulation, Describe the concept of gastrulation?...

Describe the concept of gastrulation? During embryological development this stage results in blastulas conversion into a gastrula. Cells migrate toward the inside of embryo fro

Assessment of development in children, Assessment of Development in Childre...

Assessment of Development in Children The development of a child is studied through various responses which he exhibits following a natural or experimental stimulus. Basical

What does myeloid immunodeficiency cause, Myeloid immunodeficiency causes p...

Myeloid immunodeficiency causes phagocytic function, which is impaired. Those who are affected with this will undergo with enhance in susceptibility to bacterial infection.

Abnormal violent contractions of skeletal muscles, Person Z swallowed a lar...

Person Z swallowed a large amount of substance X and, as a result, has convulsions (abnormal violent contractions of skeletal muscles).  Swallowing which of the following substance

Advantages and disadvantages of organizational charts, Advantages and Disad...

Advantages and Disadvantages: of Organizational Charts Advantages  a)  Defining the Organizational Relationship Without a,chart, many people might view the organization as

Classification of poisonous arthropods, what is the classification of poiso...

what is the classification of poisonous arthropods according to their mode of toxicity to human

Causes of diabetic ketoacidosis, Q. Causes of Diabetic Ketoacidosis? Th...

Q. Causes of Diabetic Ketoacidosis? The causes of Diabetic Ketoacidosis (DKA) are the following: - Missing of insulin injection - Infection - Trauma (injury) - Myoc

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd