Chromosome jumping, Biology

Assignment Help:

Chromosome jumping is the technique whereby one begins with a piece of DNA from one area of a chromosome, and obtains clones from nearby areas without cloning everything in between (as in chromosome walking). One round of jumping yields the new clones at the distances of several tens of kb away from the beginning point. In practice, this method is used when classical genetics proves that a known piece of DNA is located on the chromosome close to the gene you would like to clone (like a human disease gene). By cloning the fragments some distance away in both the directions from the known fragment, one might attain 
(1) fragments further from the required gene (which are discarded); 
(2) the fragments are even more closely linked to the required gene (in which case one goes for another round of jumping); or 
(3) fragments from within required gene - the optimal result. 


Related Discussions:- Chromosome jumping

Epithelial tissues., function , structure and lo of location of germinal e...

function , structure and lo of location of germinal epithelium

Multiple alleles, MULTIPLE ALLELES (i)         More than two alternativ...

MULTIPLE ALLELES (i)         More than two alternative forms (alleles) of a gene in a population occupying the same locus on a chromosome or its homologue are known as multiple

Why mosquito bites and it causes itching, Why mosquito bites and it causes ...

Why mosquito bites and it causes itching? A mosquito does not really bite you, of course. It sucks your blood. To help enable effective blood sucking, it firstly injects ant

Hydrophily - cross-pollination, Hydrophily - Cross-pollination All hyd...

Hydrophily - Cross-pollination All hydrophytes are not necessarily pollinated by water. In fact most of the aquatic plant are anemophilous, e.g. Alisma, Nymphaea. Like anemoph

Need for a transport system, Need for a transport system: Transport ...

Need for a transport system: Transport system is essential to keep the cells alive and healthy Failure of these transport systems would result in diseases Cells requir

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the types of carrageenan, Explain the types of Carrageenan It ...

Explain the types of Carrageenan It was first produced commercially from the red algae, Chandrus crispus, found along the northeast shores of the U.S and Canada and referred t

Neo-lamarckism, NEO-LAMARCKISM Modem modified form of Lamarck theory...

NEO-LAMARCKISM Modem modified form of Lamarck theory is regarded as Neo-Lamarckism. Mc Dougall (1938) found that time taken for training the mice was reducing gradually

Describe cultural characteristics of microorganisms, Q. Describe Cultural C...

Q. Describe Cultural Characteristics of Microorganisms? Bacterial growth in and on foods often is extensive enough to make the food unattractive in appearance or otherwise obj

List the routine treatment sequence for an implant patient, List the routin...

List the routine treatment sequence for an implant patient. The different phases are - Preliminary treatment - Stage I surgical phase - Stage II surgery and Prosthetic

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd