Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
CHROMOLIPID
Formed by lipid & pigment, eg. carotene, xanthophylls.
Lycopene present in tomato & red chilli.
Carrot is rich in b-carotene, converted into vitamin A.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Urinary Excretion Test - riboflavin status? Urinary excretion of riboflavin is determined at different levels of intake. Under conditions of adequate riboflavin int
State about Heller's Nitric Acid Test Take 1 ml concentrated (fuming) nitric acid in a test tube and add 2 ml of urine by means of a pipette by the side of the test tube and la
The most abundant from of phosphorous has 15 protos, 16 neutrons and 15 electrons. Which of the following is an isotope of pgisphorous? (make all correct choices) A. an atom wit
HOW TO WRITE A CONCLUSION ON A ASSIGNMENT OF EPITHELIAL TISSUES
Explain single pan balance and Electronic Digital Balance? Single Pan Balance: This is a very sensitive balance used for weighing quantities less than 10 grams. It accurately w
WRITE ON FUNGAL NUTRITION
Q. What is the valve that separates the right ventricle from the pulmonary artery? Why is that valve important? The pulmonary valve is important to prevent blood from the pulmo
Human lungs A pair of spongy, elastic and bag like structures of lungs is present in the chest cavity, one on either side of the heart. Lungs are enclosed by a double lay
Q. How does the embryo turn from gastrula into neurula? How is the neural tube formed? What is the embryonic origin of the nervous system in vertebrates? The neurula stage is c
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd