Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
CHROMOLIPID
Formed by lipid & pigment, eg. carotene, xanthophylls.
Lycopene present in tomato & red chilli.
Carrot is rich in b-carotene, converted into vitamin A.
What processes occur during the budding of yeast?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are yeast? Yeasts are unicellular fungi, which are widely distributed in nature. They are somewhat larger than bacteria. The cell length is about 10μm and the diameter
As with food crops, the "discovery, domestication and cultivation" of ornamental plants have a long history. There is indication that lilies were cultivated in China for both medi
Define Etiology - Anorexia Nervosa? The exact cause of eating disorders is not known. It is multi factorial in origin in which the personality of the patient, family relationsh
Question 1: "Plant tissue culture now has direct commercial applications" Explain. Describe plant tissue culture Illustrate importance of plant tissue culture Sho
a) In what ways do farmers try to improve the quality of (i) their soil, (ii) their crop plants? b) What other steps do farmers take to maximise the yield from their
What are the Luria's methods and theories Adhering to our theory that the Luria Nebraska bears little resemblance to Luria's methods and theories, there seems little point in i
What is Anti-arrhythmic pacemaker defibrillators ? Antiarrhythmic drugs (AADs) are classified according to whether they exert blocking actions predominantly on sodium, potassiu
What are the main limiting factors for the growth of a population? The factors that limit the growth of a population can be divided into biotic factors and abiotic factors. The
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd