Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Chemoreceptors
These are receptors included in perception of chemical stimuli. You will see that there are three kinds of Chemoreceptors among metazoans:
i) Those concerned along with general chemical sense perceived by undifferentiated nerve endings or unspecified receptors. These are distributed all over the surface of the body and are common in between lower animals such as cnidarians, worms and molluscs. The most primitive type of chemoreceptor and results in escape reaction of the animal.
ii) Chemotactile sense perceived through contact Chemoreceptors involving contact with molecules in dilute solution; they are generally present in large numbers in special regions of the body. In mammals these are located on the tongue and we call the sensation taste or gustation. But in Octopus they are concentrated around the rim of the suckers, and in insects they are present on mouthparts and in flies, they are found in abundance as well on tarsal segment of foot. So one may say that the fly tastes with their fed.
iii) Olfaction involves distant chemical sense and is the most sensitive type of chemical sense. Olfactory receptors are capable of perceiving molecules of very low concentration in air and we usually call it smell. They are distributed in high density on the antennae of insects. The combined electrical recordings of the antennal nerve generated by the odors on the olfactory receptors of the antennae are termed electroantennogram. Specific insects can recognize their mates even at a distance of a couple of kilometers, from the odour (pheromone) molecules they emit.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
describe the biting mechanism of a poisonous snake
what is cockroach respiratory system?
Does mold have roots? When mold is inside on wood - are there roots that go into substrate? I am trying to find this out today if possible to evaluate a remediator''s plan. I am wo
Name few polymers in the eukoratic cell? Name the mummers that make up the DNA? Compare and contrast between mummers of DNA VS monomers of RNA?
Person X is a healthy human who has volunteered to take experimental drug Y. Person X has a normal dinner at 6 PM on April 1 and then does not eat for 12 hours. At 5 PM on A
Elaborate Immune Response system and their categories? The immune response is a group of defenses that the body has developed to combat disease-producing agents, or pathogens.
Permanent Partial Disability - Injury from an Accident Permanent partial disability restrains the worker by doing the job he has been doing. He recovers from the injury in th
Explain puewabilitation programme in details ? Education, counselling, and behavioural interventions are important elements of cardiac rehabilitation. In this guideline, "educ
Trophic Level - Ecosystem In an ecosystem, the various biotic components are related to each other and form food chains. If we group all the organisms in a food chain accordin
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd