Centrioles, Biology

Assignment Help:

Centrioles

  • Centrioles is also called cell centre.
  • Centrosome discovered by Benden. T. Boveri called it centrosome.
  • Centrosome is present in all animal eukaryotic cells but absent in higher plants.
  • H. Fol discovered spindle fibres.
  • Two centrioles located just outside nucleus, lie at right angle to each other.
  • Surrounding cytoplasm is clear called "Centrosphere" or "Kinoplasm".
  • Centrioles + centrosphere = Centrosome or Microcentrum or Diplosome.
  • Due to clear and shining centrosphere, centrioles are previously thought as light artifact. One end of centriole is open and other end is closed.
  • Centrioles are membraneless elongated structure.
  • Centrioles exhibit "Cart Wheel Structure" (Just like Basal body of Cilia). Basal body is also a type of centriole.

 

1208_centrioles.png

  • Each centriole consists of 9 peripheral microtubules and each microtubule made up of three sub tubules which are called A, B and C. So centriole is made up of peripheral triplet.
  • Each subtubule is made up of 13 protofilaments.
  • Each protofilament is a dimer of a and b tubulin protein.
  • Microtubules of centriole are made up of tubulin protein.
  • Central microtubules are completely absent in centriole but in central part Hub protein is present.
  • Each peripheral microtubule connects with hub protein with the help of radial spoke.
  • Terminal end of radial spoke (towards peripheri) forms a dense structure called X-body, which is present near the A-subtubule.
  • Between two X bodies, a Y-body is also present.
  • Each Y-body connected to X-bodies on its both sides.
  • A-C linker connects C- sub tubule of a microtubules with A-subtubule of another microtubule.
  • Randell and Disprey discovered DNA in centriole, which is called centriolar DNA. It has not been isolated till now but its presence is confirmed. Centriolar DNA is probably circular, naked and double stranded. Centriolar DNA helps in duplication of centriole during G phase of cell division but recently it is beleived that Massules or Pericentriolar Satellites help in duplication of centriole.
  • Around each peripheral microtubule a spherical structure is present, which is called Pericentriolar Satellites or Massules. These are 9 in number.
  • Centrioles are self duplicating units, contain DNA and RNA and are capable of protein synthesis.

Related Discussions:- Centrioles

Reproductive disorders, Reproductive health disorders to dairy livestock ac...

Reproductive health disorders to dairy livestock accounts to a loss of about Rs 30,000- 50,000 crore annually to the nation. Better herd management can minimize the occurrence of d

Eugenics, Eugenics : This is the study of improvement of human races by app...

Eugenics : This is the study of improvement of human races by applying the genetic laws. In other words Eugenics is the bio-social movement & applied science that advocates the use

Chordates, what are the general characters of chordates? At least 10 charac...

what are the general characters of chordates? At least 10 characters.

Define protein requirements for physical fitness, Define Protein Requiremen...

Define Protein Requirements for physical fitness? Proteins provide energy to the body. Since exercise may increase an athlete's need for protein, depending on the type and freq

What is phenylketonuria, Q. What is Phenylketonuria? The essential amin...

Q. What is Phenylketonuria? The essential amino acid phenylketonuria is utilized for tissue protein synthesis and hydroxylated to form tyrosine. The hydroxylation reaction requ

Define terpene alcohols - non glyceride fractions, Define Terpene Alcohols ...

Define Terpene Alcohols - non glyceride fractions? Partly free, partly esterified e.g. ferulic acid; these are found in significant amounts in rice bran oil, wheal germ oil, so

Qualities of a good counsellor, It is important to know about qualities of ...

It is important to know about qualities of a counsellor because you will be counselling a diabetic patient and his family members in clinic/home/hospital and therefore, you shoul

State about the blood-aqueous barrier, State about the blood-aqueous barrie...

State about the blood-aqueous barrier There is a blood-aqueous barrier which prevents the movement of substances from the plasma to the aqueous humour. If there is a breakdown

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd