Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cellular Transport
Cellular transports demote to the movement of compounds across the outer wall or membrane of the cell. This transport is critical in two respects. Firstly, transport permits a cell to take in and release compounds in accordance along with its biological function (for instance, the uptake and let go of oxygen through red blood cells). Secondly, it permits cells to regulate features of this transport (for instance, increased transport of glucose within muscle cells during activity). This animation will help you gain a better understanding of the different kinds of transport which occur across a membrane barrier
How different is the fish epidermis from the amphibian epidermis? The fish epidermis is very thin and having mucus-secreting cells. The fish skin does not present keratin. The
why frog respire through skin
Name that gelatin-like substance which is prepared from different species of red algae growing in Asiatic waters. Prepared product appears in the form of cakes, coarse granules and
Unsaturated fatty acids require some additional processing before they can be degraded completely by β-oxidation. The Unsaturated fatty acyl CoAs with double bonds at odd-numbered
What is Rationale for Menu Planning? 'Menu', as we all know, is nothing but a list of dishes planned for preparation, and forms the very core of all activities in the food serv
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Applications of genetic engineering? Applications of genetic engineering in different fields are: • Agriculture: Crops having larger yields, drought -and disease -resis
Q. Haemodynamic Study of constrictive pericarditis? Simultaneous right and left heart studies are useful. Due to exaggerated waves in atria, W-shaped atrial pressure tracing wi
Define Reagents - Nelson Somogyi Method for Glucose Estimation? 1. Alkaline copper reagent Alkaline A- Buy commercial from SDS chemicals etc Alkaline B- Weigh 6.25 g anhy
Why Fats, Oils and Sugar are important for human body? This group imparts flavour to the items and thereby improves the palatability. Items incorporating them do melt in the mo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd