Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cellular respiration
Cellular respiration is more or less a reverse process of photosynthesis. During cellular respiration complex carbon compounds, especially the carbohydrate molecules break down into carbon dioxide, releasing energy. This is a catabolic reaction. Fats and proteins also undergo catabolic reactions. The energy released is used by the living system for various activities. To be more precise, energy released during biological oxidation of the complex carbon molecules such as carbohydrates fats and protein, is trapped by the organism into adenosine triphosphate (ATP).
ATP is a high-energy phosphate, which can be stored in the cell. From this stored 'ATP, energy, can be tapped instantaneously. This is the source of energy for various activities of organisms. The electrons released during the process are passed on through a series of electron carriers in the electron transfer chain within the mitochondria where essentially hydrogen and oxygen combine to for& water. You would have studied more about these aspects in Cell Biology.
Q. Counselling skills used in diabetes mellitus? Information gathering is an important skill for understanding of the client. Behaviour is complex and, therefore it is importan
Problem 1: What is Placebo and Nocebo? Describe the significance of Placebo in clinical trials. Definition of placebo and Nocebo Significance of Placebo in clinical t
i want to know about sericulture for assignment degree level
A healthy person is on a diet that consists of very small amounts of water. A. This person will have high water permeability across the luminal membranes of the medullary colle
You have identified a protein in a cell that you know that comes from the human body. With respect to that protein you have also determined that it allows sodium ions to go through
why are they called as pisces
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Hi,I am a graduating student from my course BS in Biology major in Zoology. I was wondering if you guys have any great idea of a good thesis title?
Leishmanias – Flagellates Species of the genus Leishmania are parasites of mammals including man. Leishmanias infections occur over wide regions of the world from Asia, the ne
The modern water treatment plan is often called upon to perform wonders with the water fed to it. The clear, safe , even tasteful water that comes from a faucet may have started a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd