Cellular respiration, Biology

Assignment Help:

Cellular respiration

Cellular respiration is more or less a reverse process of photosynthesis. During cellular respiration complex carbon compounds, especially the carbohydrate molecules break down into carbon dioxide, releasing energy. This is a catabolic reaction. Fats and proteins also undergo catabolic reactions. The energy released is used by the living system for various activities. To be more precise, energy released during biological oxidation of the complex carbon molecules such as carbohydrates fats and protein, is trapped by the organism into adenosine triphosphate (ATP).

ATP is a high-energy phosphate, which can be stored in the cell. From this stored 'ATP, energy, can be tapped instantaneously. This is the source of energy for various activities of organisms. The electrons released during the process are passed on through a series of electron carriers in the electron transfer chain within the mitochondria where essentially hydrogen and oxygen combine to for& water. You would have studied more about these aspects in Cell Biology.


Related Discussions:- Cellular respiration

How are the male gametophytes formed in angiosperms, Q. How are the male ga...

Q. How are the male gametes and the male gametophytes formed in angiosperms? In the anthers of every stamen there are pollen sacs. Inside the pollen sacs there are microspore m

Cyclins and cyclin-dependent kinases, Rhythmic fluctuations in the abundanc...

Rhythmic fluctuations in the abundance and activity of cell-cycle control molecules pace the events of the cell cycle. • Kinase - a protein which activates or deactivates another

Significance of apomixis, Significance of Apomixis Apomixis offers th...

Significance of Apomixis Apomixis offers the possibility of indefinite multiplication of especially favorable biotypes without any variation due to segregation or recombinati

Explain briefly Creutzfeldt-jakob disease (cjd), Normal 0 false...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Name the one autosomal dominant and autosomal, Name the one autosomal domin...

Name the one autosomal dominant and autosomal recessive Mendel an disorder in Humans. a) How is the action of exonucluease dissimilar from that of end nuclease? b) India has

St-segment in exercise induced pvc, Q. What do you mean by  ST-Segment in ...

Q. What do you mean by  ST-Segment in Exercise Induced  PVC? Ans. Over the years it has been believed that repolarization in ventricular ectopic beats had no diagnostic si

What are the uses of whey protein concentrates, What are the uses of whey p...

What are the uses of whey protein concentrates? Whey protein concentrates are used extensively in the manufacture of baked goods, where they increase the effectiveness of short

Define prevention of idd by iodized oil, Define prevention of idd by Iodize...

Define prevention of idd by Iodized Oil? The other approach employed as a specific measure for women and children in hyper-endemic areas is injection of iodized oil. Intramuscu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd