Cellular respiration, Biology

Assignment Help:

Cellular respiration

Cellular respiration is more or less a reverse process of photosynthesis. During cellular respiration complex carbon compounds, especially the carbohydrate molecules break down into carbon dioxide, releasing energy. This is a catabolic reaction. Fats and proteins also undergo catabolic reactions. The energy released is used by the living system for various activities. To be more precise, energy released during biological oxidation of the complex carbon molecules such as carbohydrates fats and protein, is trapped by the organism into adenosine triphosphate (ATP).

ATP is a high-energy phosphate, which can be stored in the cell. From this stored 'ATP, energy, can be tapped instantaneously. This is the source of energy for various activities of organisms. The electrons released during the process are passed on through a series of electron carriers in the electron transfer chain within the mitochondria where essentially hydrogen and oxygen combine to for& water. You would have studied more about these aspects in Cell Biology.


Related Discussions:- Cellular respiration

Differentiate between the five kingdoms of organisms, Question 1: (a) G...

Question 1: (a) Give, in order, the major categories of taxonomic classification. (b) Differentiate between the five kingdoms of organisms. (c) Differentiate between net

Explain the technique of balloon mitral valvuloplasty, Q. Explain the Techn...

Q. Explain the Technique of Balloon Mitral Valvuloplasty? The procedure is performed by cannulation of the right femoral vein and the procedure is similar upto transseptal punc

Sketch cis-trans isomer of the first molecule, Please help with the followi...

Please help with the following: a) Draw a diagram (showing all the C and H atoms, and their bonds) for a hydrocarbon with 5 carbons with a double bond between carbons 2 and 3.

Fiehes test and aniline chloride test, Q. Fiehes test and Aniline chloride ...

Q. Fiehes test and Aniline chloride test? Determine the adulteration in the given honey sample by Fiehe's test and Aniline chloride test This activity will help you to: •

Structural differences between roots and shoots, What are the structural di...

What are the structural differences between roots and shoots? What structures are unique to each?

Operative requirements for stage i surgery, Operative requirements for stag...

Operative requirements for stage i surgery Although Implant placement under general anesthesia must be done in an operating theatre with complete resources, most implant surger

Determine the sucrose content in a sample of honey, Q. Determine the sucros...

Q. Determine the sucrose content in a sample of honey? This activity will help you to: • estimate the non-reducing sugars and total sugars in a sample of honey, • check t

How are sponges characterized, Q Sponge identity card. How are sponges char...

Q Sponge identity card. How are sponges characterized according to example of representing beings, basic morphology, type of symmetry, embryonic (germ) layers and coelom, digestive

Lung abscess, Lung Abscess: Lung  abscess  is a localised collection o...

Lung Abscess: Lung  abscess  is a localised collection of pus in  the pulmonary parenchyma as a result of  suppuration and necrosis. The obstruction  of the bronchus of the in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd