Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cellular respiration
Cellular respiration is more or less a reverse process of photosynthesis. During cellular respiration complex carbon compounds, especially the carbohydrate molecules break down into carbon dioxide, releasing energy. This is a catabolic reaction. Fats and proteins also undergo catabolic reactions. The energy released is used by the living system for various activities. To be more precise, energy released during biological oxidation of the complex carbon molecules such as carbohydrates fats and protein, is trapped by the organism into adenosine triphosphate (ATP).
ATP is a high-energy phosphate, which can be stored in the cell. From this stored 'ATP, energy, can be tapped instantaneously. This is the source of energy for various activities of organisms. The electrons released during the process are passed on through a series of electron carriers in the electron transfer chain within the mitochondria where essentially hydrogen and oxygen combine to for& water. You would have studied more about these aspects in Cell Biology.
Q. How are the male gametes and the male gametophytes formed in angiosperms? In the anthers of every stamen there are pollen sacs. Inside the pollen sacs there are microspore m
Rhythmic fluctuations in the abundance and activity of cell-cycle control molecules pace the events of the cell cycle. • Kinase - a protein which activates or deactivates another
Significance of Apomixis Apomixis offers the possibility of indefinite multiplication of especially favorable biotypes without any variation due to segregation or recombinati
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Name the one autosomal dominant and autosomal recessive Mendel an disorder in Humans. a) How is the action of exonucluease dissimilar from that of end nuclease? b) India has
#what is adaptation?
Q. What do you mean by ST-Segment in Exercise Induced PVC? Ans. Over the years it has been believed that repolarization in ventricular ectopic beats had no diagnostic si
What are the uses of whey protein concentrates? Whey protein concentrates are used extensively in the manufacture of baked goods, where they increase the effectiveness of short
Define prevention of idd by Iodized Oil? The other approach employed as a specific measure for women and children in hyper-endemic areas is injection of iodized oil. Intramuscu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd