Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Explain about Bequest value of biodiversity? Sometimes people derive satisfaction from the fact that conserved biodiversity may benefit other individuals in the future, givi
Q. What are age pyramids? Age pyramids are the graphical representations in form of superposed rectangles each representing the number of individuals included in age ranges int
Diaphragmatic Hernia: In this condition there is a slight herniation ofabdominal organs (stomach intestine and liver) or extreme protrusion of abdominal contents into the th
how do we write a limerick spell?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Motor nerves : Nerves which carry impulses from brain or spinal cord to effector organs are called efferent or motor nerves. Stimulation of motor nerves makes the muscles to contr
Which of the vertebrate classes (a) are 'warm-blooded', (b) reproduce by laying eggs? (a) Birds and mammals are 'warm-blooded'. (b) Fish, Amphibia, Reptiles
Q. Zonation in the ocean? The oceans play a major role in determining the climate and sustaining life on earth. Oceans help to redistribute the solar energy, through ocean curr
Careful palpation of the upper and lower limb pulses would make one suspect coarctation as the cause of hypertension. The lower limb pulses are weak and delayed. Confirmation ca
Causes of Degradation of Ecosystem Due to Agriculture Degradation of the ecosystem due to agriculture can be on the following accounts: a) Removal of trees (deforestation
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd