Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cell wall is the structure produced by some of the cells outside their cell membrane; variously composed of the chitin, peptidoglycan, or cellulose.
Explain the Pathogens of forest insects? Caterpillars that defoliate forest trees have main economic impacts. Many such species go through periodic outbreaks. The forces which
Listeriosis The organisms have an extensive host range which includes mammal, poultry, fish, crustaceans and ticks including man. The organism has been isolated from sheep, goats,
What are the segments that form the body of the tapeworm called? What is their function? The body of the tapeworm is made of segments known as proglottids. The proglottids are
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Gluconeogenesis Gluconeogenesis is the procedure through that glucose is synthesized from smaller easier molecules such as lactate and pyruvate. Although the catabolic linear p
What is Kingdom Protista in diversity of life? Members of Kingdom Protista are grouped separately from the other eukaryotic kingdoms because most of the organisms have a unicel
Cell body in a neuron, the part which contains the nucleus and most of the cytoplasm and organelles. Cell cycle It is the sequence of events from one division of the cell to
Q. How many carbon dioxide (CO 2 ) molecules are liberated after each cycle of the Krebs cycle? For a single glucose how many carbon dioxide molecules were already liberated by the
What is Vegetarianism? Protein quality of the vegetarian diets can be improved by proper diet planning, However, under free-living conditions, vegetarianism can limit pr
explain osmoregulation in crustacean ?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd