Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cell Theory
The invention of the compound microscope in the 17th century stimulated the interest in living things not visible to the naked eyes. Thus, Robert Hooke discovered 'cells' in 1665 by examining cork slices (,under a crude microscope. He was actually describing the spaces occupied by the cells limited by the cellulose walls. Hooke and his contemporaries also described cells from other plants and animals.
Figure: A generalized plant (a) and animal (b) cell. No one cell of either plant (a) or animal (b) has all the characteristics shorn in these composite figures. Both these are
However, cell theory, one of the greatest and most basic generalizations of biology, was formulated only about 200 years later. Two German investigators, Schleiden a botanist (1838), and Schwann, a zoologist (1839) are credited with presenting independently the first concise, yet comprehensive, statements about the cell. They pointed out that, "All plants and. animals are made up of small fundamental units called cells and that some organisms are unicellular and others, multicellular." Subsequent researched to the expansion of this concept by including further information on cells. We know that cells are surrounded by cell membrane and contain cytoplasm and nucleus and, most importantly, cells divide into roughly equal daughter cells by a process called cell division. Thus it became known that new cells come into existence only by the division of previously existing cells. In other words, cells do not arise by spontaneous generation from nonliving matter. It follows that all cells living today can trace their ancestry back to those which existed in ancient times.
Seminal plasma in human males is rich in : 1. fructose and calcium 2. glucose and calcium 3. DNA and testosterone 4. ribose and potassium Fructose and Calcium
Cilia and Flagella – Protozoans Cilia and flagella basically have a similar structure and distinction between the two on structural basis does not exist. There is a filament o
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
PR E FORMATION THEORY - Proposed by Marcello Malpighi. Studied chick egg and proposed his work in "De ova-incubato". According this different part of embryo previousl
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
phylum porifera
Define Miscellaneous Functions of Protein? Besides the functions enumerated above certain other important miscellaneous functions of proteins are included herewith. These inclu
Micro Debrider: long , it's tip as hand spreader, not smooth and resemble H file. - These instruments have a hedstrom cutting configuration with a standard 0.02 taper and
STRUCTUR E OF A MYOFIBRIL - The dark bands of the myofibril are termed the A-bands (Anisotropic bands). Each A-band has at its middle a light zone called H-zone (Henson'
how can i earn money by submitting assignments?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd