Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cell Theory
The invention of the compound microscope in the 17th century stimulated the interest in living things not visible to the naked eyes. Thus, Robert Hooke discovered 'cells' in 1665 by examining cork slices (,under a crude microscope. He was actually describing the spaces occupied by the cells limited by the cellulose walls. Hooke and his contemporaries also described cells from other plants and animals.
Figure: A generalized plant (a) and animal (b) cell. No one cell of either plant (a) or animal (b) has all the characteristics shorn in these composite figures. Both these are
However, cell theory, one of the greatest and most basic generalizations of biology, was formulated only about 200 years later. Two German investigators, Schleiden a botanist (1838), and Schwann, a zoologist (1839) are credited with presenting independently the first concise, yet comprehensive, statements about the cell. They pointed out that, "All plants and. animals are made up of small fundamental units called cells and that some organisms are unicellular and others, multicellular." Subsequent researched to the expansion of this concept by including further information on cells. We know that cells are surrounded by cell membrane and contain cytoplasm and nucleus and, most importantly, cells divide into roughly equal daughter cells by a process called cell division. Thus it became known that new cells come into existence only by the division of previously existing cells. In other words, cells do not arise by spontaneous generation from nonliving matter. It follows that all cells living today can trace their ancestry back to those which existed in ancient times.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Difference between Vegetative and Generative Cell The cytoplasm of the vegetative cell and the generative cell is distinctly different. The generative cell is transparent and
what type of gametes would be produced from genotype AA, Bb, AABb and someone who is heterozygous for 3 traits
What is a community? What is the difference among the methods of community and population? A community is a set of populations of living beings that live in the similar region
Explain the Protein Energy Malnutrition (PEM)? Protein Energy Malnutrition (PEM) is the deficiency of macronutrients or energy and protein in the diet and forms the most import
Results : Pericardiectomy used to have a mortality of 10-15 per cent in the earlier era. At present it is around 3 to 5 per cent and does not approach 0 per cent even though it
What are the typical vegetation and the typical fauna of the tropical forests? In the vegetation of a tropical forest broadleaf evergreen trees predominate. On the top of the t
Differentiate between Total Fertility Rate (TFR) and Replacement Level (RL) Due to uncontrolled excessive hunting the population of tigers in a forest becomes Zero. Discuss the
Explain the chemical properties of milk Autoclaving milk, wherein temperature of around 121 o C is achieved, causes browning. The brown colour is due to the heat effecting an i
1. How often should she have Glycated hemoglobin (HgbA1C) drawn? What percentage is desired? 2. How often should she see an ophthalmologist or optometrist? 3. What should be
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd