Cell theory, Biology

Assignment Help:

Cell Theory

The invention  of  the  compound microscope  in  the 17th century stimulated the  interest in living things not  visible  to  the  naked  eyes. Thus, Robert Hooke discovered  'cells'  in 1665 by  examining cork  slices  (,under  a crude microscope. He was  actually describing  the spaces occupied by  the cells  limited by  the cellulose walls. Hooke and his contemporaries also described cells from other plants  and  animals.

 

1299_Cell Theory.png

Figure: A generalized plant (a) and animal (b) cell. No one cell of either plant (a) or animal (b) has all the characteristics shorn in these composite figures. Both these are

 

However, cell theory, one of  the  greatest  and most basic generalizations of  biology, was formulated only  about 200 years later. Two German  investigators, Schleiden a botanist (1838), and Schwann, a zoologist  (1839) are credited with  presenting  independently the first concise, yet  comprehensive, statements about the cell. They  pointed out  that, "All plants and. animals are made up of  small fundamental units called cells and that some organisms are unicellular and others, multicellular." Subsequent researched  to the expansion of  this concept by  including further information on  cells. We  know that cells are surrounded by  cell membrane and contain cytoplasm and  nucleus and, most importantly, cells divide into  roughly  equal daughter cells by  a process called  cell division. Thus it became known  that new  cells come into existence only by the division of  previously  existing cells.  In  other words,  cells do not  arise by spontaneous generation  from  nonliving matter. It  follows that all cells living  today  can trace their ancestry back  to those which  existed  in  ancient times.

 


Related Discussions:- Cell theory

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Difference between vegetative and generative cell , Difference between Vege...

Difference between Vegetative and Generative Cell The cytoplasm of the vegetative cell and the generative cell is distinctly different. The generative cell is transparent and

Gametes and genotypes, what type of gametes would be produced from genotype...

what type of gametes would be produced from genotype AA, Bb, AABb and someone who is heterozygous for 3 traits

Explain the the methods of community and population, What is a community? ...

What is a community? What is the difference among the methods of community and population? A community is a set of populations of living beings that live in the similar region

Explain the protein energy malnutrition (pem), Explain the Protein Energy M...

Explain the Protein Energy Malnutrition (PEM)? Protein Energy Malnutrition (PEM) is the deficiency of macronutrients or energy and protein in the diet and forms the most import

Results of pericardial diseases, Results :  Pericardiectomy used to have a...

Results :  Pericardiectomy used to have a mortality of 10-15 per cent in the earlier era. At present it is around 3 to 5 per cent and does not approach 0 per cent even though it

What are typical fauna of the tropical forests, What are the typical vegeta...

What are the typical vegetation and the typical fauna of the tropical forests? In the vegetation of a tropical forest broadleaf evergreen trees predominate. On the top of the t

Explai total fertility rate and replacement level, Differentiate between To...

Differentiate between Total Fertility Rate (TFR) and Replacement Level (RL) Due to uncontrolled excessive hunting the population of tigers in a forest becomes Zero. Discuss the

Explain the chemical properties of milk, Explain the chemical properties of...

Explain the chemical properties of milk Autoclaving milk, wherein temperature of around 121 o C is achieved, causes browning. The brown colour is due to the heat effecting an i

Diabetes mellitus, 1. How often should she have Glycated hemoglobin (HgbA1C...

1. How often should she have Glycated hemoglobin (HgbA1C) drawn?  What percentage is desired? 2. How often should she see an ophthalmologist or optometrist? 3. What should be

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd