Cell theory, Biology

Assignment Help:

Cell Theory

The invention  of  the  compound microscope  in  the 17th century stimulated the  interest in living things not  visible  to  the  naked  eyes. Thus, Robert Hooke discovered  'cells'  in 1665 by  examining cork  slices  (,under  a crude microscope. He was  actually describing  the spaces occupied by  the cells  limited by  the cellulose walls. Hooke and his contemporaries also described cells from other plants  and  animals.

 

1299_Cell Theory.png

Figure: A generalized plant (a) and animal (b) cell. No one cell of either plant (a) or animal (b) has all the characteristics shorn in these composite figures. Both these are

 

However, cell theory, one of  the  greatest  and most basic generalizations of  biology, was formulated only  about 200 years later. Two German  investigators, Schleiden a botanist (1838), and Schwann, a zoologist  (1839) are credited with  presenting  independently the first concise, yet  comprehensive, statements about the cell. They  pointed out  that, "All plants and. animals are made up of  small fundamental units called cells and that some organisms are unicellular and others, multicellular." Subsequent researched  to the expansion of  this concept by  including further information on  cells. We  know that cells are surrounded by  cell membrane and contain cytoplasm and  nucleus and, most importantly, cells divide into  roughly  equal daughter cells by  a process called  cell division. Thus it became known  that new  cells come into existence only by the division of  previously  existing cells.  In  other words,  cells do not  arise by spontaneous generation  from  nonliving matter. It  follows that all cells living  today  can trace their ancestry back  to those which  existed  in  ancient times.

 


Related Discussions:- Cell theory

Define seminal plasma in human male, Seminal plasma in human males is rich ...

Seminal plasma in human males is rich in : 1. fructose and calcium 2. glucose and calcium 3. DNA and testosterone 4. ribose and potassium Fructose and Calcium

Cilia and flagella – protozoans, Cilia and Flagella – Protozoans Cilia...

Cilia and Flagella – Protozoans Cilia and flagella basically have a similar structure and distinction between the two on structural basis does not exist. There is a filament o

Lymphatic system - circulation, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Theory of embryology - pre-formation theory, PR E FORMATION THEORY - ...

PR E FORMATION THEORY - Proposed by Marcello Malpighi. Studied chick egg and proposed his work in "De ova-incubato". According this different part of embryo previousl

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define miscellaneous functions of protein, Define Miscellaneous Functions o...

Define Miscellaneous Functions of Protein? Besides the functions enumerated above certain other important miscellaneous functions of proteins are included herewith. These inclu

Micro debrider-therma-fill, Micro Debrider: long , it's tip as hand spr...

Micro Debrider: long , it's tip as hand spreader, not smooth and resemble H file. -    These instruments have a hedstrom cutting configuration with a standard 0.02 taper and

Structure of myofibril, STRUCTUR E OF A MYOFIBRIL - The dark bands ...

STRUCTUR E OF A MYOFIBRIL - The dark bands of the myofibril are termed the A-bands (Anisotropic bands). Each A-band has at its middle a light zone called H-zone (Henson'

Botany, how can i earn money by submitting assignments?

how can i earn money by submitting assignments?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd