Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Primary Prevention: Primary prevention should have the following goals: i) Ascertaining at the risk population and the high risk situations where stressful life events a
Q. Why is AIDS difficult to prevent by vaccination? It is not easy to produce a vaccine against AIDS because the HIV is a highly mutant virus. In approximately every replicatio
Which terrestrial vertebrate group is extremely rare in deserts? Amphibians are terrestrial vertebrates extremely rare in desert environments (although there are a some species
State two procedures which are used to reduce the chances of a kidney graft being rejected Drugs are used to suppress the patient's immune response to foreign tissue. The dono
Define the V2 receptor antagonist A new drug named ANTI-V2R has been developed that is a V2 receptor antagonist. When ANTI-V2R binds to a V2 receptor, there is no binding of v
What do you understand by Parapodia? Paired lateral, unjointed appendages of polychaete worms. Parapodia have a variety of shapes, and their appearance is related to their nume
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Environmental Factors influencing food production? You probably know that no agricultural region has a constant climate throughout the year. This is true even in the tr
Define the Disturbances in Fluid Balance? The correct functioning of cells and tissues depends on appropriate concentrations of nutrients; so any abnormal loss or accumulation
Q. What is visual accommodation? Visual accommodation is the phenomenon of varying the curvature of the crystalline lens to make possible the difference of its refractivity to
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd