Carditis, Biology

Assignment Help:

It has been shown by prospective studies that Rheumatic heart disease (RHD) is linked to the occurrence of carditis during the first episode of ARF. If the first episode is accompanied with carditis, the recurrences also manifest carditis. Around 40 per cent cases of ARF develop carditis and 66 per cent of ARF patients with carditis develop RHD on follow up. During carditis (which is always pancarditis), Carey-Coombs murmur of acute valvulitis is audible. Since mitral regurgitation is the commonest valvular lesion during ARF, one hears a pansystolic murmur and middiastolic flow murmur at mitral area. Basal early diastolic murmur due to aortic regurgitation may be audible. The pulmonary and tricuspid valves are rarely involved. Pericarditis, pericardial effusion and arrhythmias (1st and 3rd degree heart blocks) are other features of rheumatic carditis.

1845_Carditis.png

Pericarditis is diagnosed by characteristic chest pain, pericardial rub, typical ECG changes or presence of pericardial fluid on 2D-Echo. Myocarditis presents as tachycardia, distant heart sounds, heart enlargement or signs of congestive cardiac failure (CCF).


Related Discussions:- Carditis

Determine possible polypeptides, a) The image above is part of a DNA sequen...

a) The image above is part of a DNA sequencing gel. Assuming this is the DNA coding strand and you are reading 5' -> 3' what are ALL the possible polypeptides this sequence cou

What percentage of the father''s body was covered by burns, The Jones famil...

The Jones family was caught in a fire but escaped. Unfortunately the father and daughter suffered burns. The father had second degree burns on his chest, abdomen, and both arms, an

What are the features of hnrna, Q. What are the features of hnRNA? Hete...

Q. What are the features of hnRNA? Heterogeneous nuclear RNA (hnRNA) - Primary precursor mRNA transcript made in eukaryotic nucleus are called 'hnRNA,' an abbreviation for 'het

Physiological & socio psychological factor- public nutrition, Define Physio...

Define Physiological and Socio Psychological Factors - public nutrition? Food related behaviour depends on a combination of biochemical factors, mainly, physiological aspects a

What is the difference between aerobic and anaerobic beings, What is the di...

What is the difference between aerobic and anaerobic beings? Aerobic organisms are those whose cells do not survive without oxygen as they depend on aerobic cell respiration to

Plate tectonic theory, Plate Tectonic Is a Theory of Geology Which describe...

Plate Tectonic Is a Theory of Geology Which describes the large scale motion of earth's lithosphere. The theory builds on the older theory of continental drift from the first half

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Ethylene - apical dominance, Ethylene - Apical Dominance Ethylene also...

Ethylene - Apical Dominance Ethylene also plays a role in the inhibition of lateral bud growth. It is present in those tissues like shoot apex where auxins are also present. I

What are the main arguments that favor evolutionism, In the scientific comp...

In the scientific competition against fixism what are the main arguments that favor evolutionism? The major arguments in favor of evolutionism are: paleontological, from the st

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd