Cardiac cycle, Biology

Assignment Help:

Cardiac Cycle

Cardiac cycle has two phases-systole and diastole. Ventricular systole and diastole occur as a result of depolarization and chamber volume and pressure. The diastolic phase of both ventricles normally occurs simultaneously. 

This phase of ventricular myocardial relaxation permits emptying of atrial contents through the open atrio-ventricular valves (tricuspid and bicuspid or mitral). Rapid ventricular filling, a passive gravity flow of blood form atria to ventricles of starts when atrial pressure exceeds ventricular pressure and AV valves open. Increasing blood volume causes ventricular pressure to rise, which slows further filling. Atrial musculature contracts propelling additional blood into the ventricle before ventricular contraction (atrial systole ).

There is increase in myocardial tension and intra-ventricular pressure without change in blood volume. AV. Valves dose. For one short period, all the valves are closed until, with ventricular depolarization, the pressure in the ventricles exceeds that of pulmonary artery and aorta. (Isovolumetric ventricular contraction).

The systolic phase is the active contraction of the ventricular myocardium causing ejection of blood into the pulmonary artery and aorta. The right and left ventricle contract simultaneously. Systole begins when the semi- lunar valves open and end when they close. The higher pressure in the aorta and pulmonary artery than that in ventricles causes the closure of the semi-lunar valves. With each contraction, a volume of blood is ejected, called the stroke volume. Normal stroke volume (SV) is approximately 70 ml.

Cardiac output = SV x Heart rate /minute.

Three important factors affecting stroke volume and in turn cardiac output, are preload, contractility and after load. Preload is related to the volume of blood distending the ventricles at the end of diastole. Contractility refers to a change in the inotropic state of the muscle without a change in myocardial fiber length or preload. After load is the amount of tension the ventricle must develop during contraction to eject blood from the left ventricle into the aorta.

The 'lub-dub' sounds heard on auscultation corresponds with the closure of heart valves. The 'lub' sound corresponds with closure of AV valves at the beginning of ventricular systole and 'dub' sound corresponds with the closure of semilunar valves at the end of ventricular systole.


Related Discussions:- Cardiac cycle

Define surface properties of proteins, Define Surface properties of Protein...

Define Surface properties of Proteins? The surface properties relates primarily to surface tension, emulsification and foaming characteristics of proteins, which are discussed

Foot-and-mouth disease, Foot-and-mouth disease Foot-and-mouth disease ...

Foot-and-mouth disease Foot-and-mouth disease (FMD) is an extremely contagious viral disease of cloven footed animals most notably cattle, pig and sheep. It is well known for

Explain ground system, G round system:  Plant tissue system, composed com...

G round system:  Plant tissue system, composed commonly of parenchyma cells with some collenchyma and sclerenchyma cells, that occupies the space between the epidermis and the va

Explain the occurrence of vitamin B6, Explain the Occurrence of vitamin B 6...

Explain the Occurrence of vitamin B 6 Vitamin B 6 activity is attributed to the 3 compounds-pyridoxol (pyridoxine), pyridoxal and pyridoxamine, generally comprised in the vit

What do digestive enzymes do to food, What do digestive enzymes do to food?...

What do digestive enzymes do to food? Digestive enzymes suspend food; make food soluble, break large insoluble food molecules into smaller, soluble molecules

How many will be homozygous for dominant allele, In a Population that is in...

In a Population that is in Hardy-Weinberg equilibrium, the frequency of the recessive Homozygous genotype is 0.49. The frequency of individuals Homozygous for the Dominant allele i

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Rational in individual patient, Thiazide diuretics have been accepted as th...

Thiazide diuretics have been accepted as the primary foundation of antihypertensive therapy. The basis of this choice is that, apart from their primary hypotensive effect, they enh

Explain red anthocyanin pigments, Explain Red anthocyanin pigments Red ...

Explain Red anthocyanin pigments Red anthocyanin pigments from miracle fruit were isolated and tested in carbonated beverages, in combination with the organic acids. Pigments d

Explain fixed-dose combination of tuberculosis, Fixed-Dose Combinations  ...

Fixed-Dose Combinations  A combination formulation of rifampin, isoniazid and pyrazinamide (Rifater) is approved by the FDA for the initial 2 months of daily anti-tuberculosis

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd