Carbohydrates, Biology

Assignment Help:

Carbohydrates

Fifty five to seventy per cent of the required energy in animals is derived from carbohydrates. However, fats and proteins can also be broken down and used for supplying energy. In most animals this happens only when the dietary intake of carbohydrates is low. In contrast, Drosophila uses only carbohydrates as a source of energy for its flight muscles and when the supply is exhausted the insect cannot fly even though it uses stored fat for other metabolic processes. Whereas, locusts are known to use only lipids for their long migratory flights. Most animals, however, use a variety of hexose sugars like glucose, fructose, mannose, and galactose as interchangeable sources of energy.

In this way no particular carbohydrate is really considered essential in a way similar to amino acids. But even if no carbohydrate is considered essential, growth of certain animals will be better on one type of sugar than on another. This can be explained better by the results of the following experiment. Young locusts showed that when dietary sugar was maltose growth was maximum or optimum and growth was minimum when no carbohydrate was given. Other sugars supported sub-optimal growth. What could be the reason for this difference? One of the main causes is the difference in the rate of movement of sugars across the gut wall into the blood. From the above experiment we can conclude that certain insects have a preference for a certain carbohydrate which can be called an essential or preferred nutrient. In the above experiment with locusts, maltose was the preferred nutrient.


Related Discussions:- Carbohydrates

Explain tetanus and diphtheria, Tetanus and Diphtheria  Everyone who ha...

Tetanus and Diphtheria  Everyone who has had a primary series as a child should receive a tetanus-diphtheria toxoid (Td) booster injection once every 10 years. Before traveling

Explain terms retrogradation and gelatinization, What do you understand by ...

What do you understand by the terms retrogradation and gelatinization? The realignment of the amylose and amylopectin and swollen starch granules to form a pocket is termed

ECOLOGICAL PYRAMIDS, Ask questionLIMITATION OF ECOLOGICAL PYRAMIDS #Minimu...

Ask questionLIMITATION OF ECOLOGICAL PYRAMIDS #Minimum 100 words accepted#

Show the artificial keys, Q. Show the Artificial Keys? These are based ...

Q. Show the Artificial Keys? These are based on the resemblances and differences of some prominent characters in the taxa. These are based on the phylogenetic relationship b

How dna molecules are formed, As a result of DNA replication two DNA molecu...

As a result of DNA replication two DNA molecules come into existence. Why is it not correct to assert that two "new" DNA molecules are created? What is the name given to the proces

How different is the amphibian heart from the fish heart, How different is ...

How different is the amphibian heart from the fish heart? The fish heart has only two chambers, a ventricle and an atrium, and the blood that comes to it is purely venous. I

Explain empiric initial therapy, Empiric Initial Therapy  Until suscept...

Empiric Initial Therapy  Until susceptibility results are available, empiric initial treatment consists of a 4-drug regimen of isoniazid, rifampin, pyrazinamide and ethambutol.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Why the recipient important in transfusions, Why is the determination of th...

Why is the determination of the blood types of the donor and of the recipient important in transfusions? Red blood cells have dissimilar antigens in the outer surface of their

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd