Can you explain pneumothorax, Biology

Assignment Help:

Q. Can you explain Pneumothorax?

Air in the pleural cavity manifests in a number of ways on the CXR, depending on the volume of air and position of the patient. The typical findings of a pneumothorax are an area of marked radiolucency, with absent vascular markings, and visibility of the adjacent lung margin. On an erect film, a small pneumothorax would be identified at the lung apex. Larger pneumothoraces are easily identified by their radiolucency and the adjacent collapsed lung. A tension pneumothorax would increase the volume of the ipsilateral thoracic cavity by flattening the diaphragm, widening the rib interspaces, displacing the mediastinum to the opposite side and causing complete collapse of the lung.


Related Discussions:- Can you explain pneumothorax

Who is known as father of english botany, Who is known as Father of English...

Who is known as Father of English Botany? William Turner (1515-1568), whose 'A New Herbal' printed in English appeared in 1551 (first part), 1562 (second part) and 1568 (third

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is physiologic adaptation, Physiologic Adaptation Modeling is a su...

Physiologic Adaptation Modeling is a surface specific activity (apposition or resorption) that produces a net change in the size and/or shape of the bone. It is an uncoupled pr

Digestion, summarise the comparative anatomy of the digestive system of the...

summarise the comparative anatomy of the digestive system of the invertebrate and the vertebrate.

Explain congenital heart disease, Explain congenital heart disease ? No...

Explain congenital heart disease ? No systematic surveys have been conducted to estimate the incidence of CHD at birth in India and other developing countries. As a result ther

Popularity of chromatography - basic separation technique, Define Popularit...

Define Popularity of Chromatography - Basic Separation Technique? Chromatography is popular because: (a) minute quantities can be analysed qualitatively and quantitatively,

Gram positive & gram negative bacteria , What is the difference among Gram ...

What is the difference among Gram positive & Gram negative bacteria based on cell content? Ans) The cell membrane is made if more of lipoproteins in gram negative compared to gr

Explain the term- pedon and polypedon, Explain the term- pedon and polypedo...

Explain the term- pedon and polypedon The characteristics of soil do not change vertically downwards only, there are lateral variations also as soil is a three dimensional body.

What is biosynthetic pathways, The intermediates in the cycle give precurso...

The intermediates in the cycle give precursors for various biosynthetic pathways. An instance is as given below: -  From citrate synthesis of fatty acids; -  Amino acid synth

Echinodermata - regeneration in invertebrates, Echinodermata - Regeneration...

Echinodermata - Regeneration in Invertebrates Asteroids (starfishes), ophiuroids (brittle stars) and crinoids (sea lilies) can reproduce their lost arms and although parts of

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd