Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Can you explain Pneumothorax?
Air in the pleural cavity manifests in a number of ways on the CXR, depending on the volume of air and position of the patient. The typical findings of a pneumothorax are an area of marked radiolucency, with absent vascular markings, and visibility of the adjacent lung margin. On an erect film, a small pneumothorax would be identified at the lung apex. Larger pneumothoraces are easily identified by their radiolucency and the adjacent collapsed lung. A tension pneumothorax would increase the volume of the ipsilateral thoracic cavity by flattening the diaphragm, widening the rib interspaces, displacing the mediastinum to the opposite side and causing complete collapse of the lung.
Who is known as Father of English Botany? William Turner (1515-1568), whose 'A New Herbal' printed in English appeared in 1551 (first part), 1562 (second part) and 1568 (third
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Physiologic Adaptation Modeling is a surface specific activity (apposition or resorption) that produces a net change in the size and/or shape of the bone. It is an uncoupled pr
summarise the comparative anatomy of the digestive system of the invertebrate and the vertebrate.
Explain congenital heart disease ? No systematic surveys have been conducted to estimate the incidence of CHD at birth in India and other developing countries. As a result ther
Define Popularity of Chromatography - Basic Separation Technique? Chromatography is popular because: (a) minute quantities can be analysed qualitatively and quantitatively,
What is the difference among Gram positive & Gram negative bacteria based on cell content? Ans) The cell membrane is made if more of lipoproteins in gram negative compared to gr
Explain the term- pedon and polypedon The characteristics of soil do not change vertically downwards only, there are lateral variations also as soil is a three dimensional body.
The intermediates in the cycle give precursors for various biosynthetic pathways. An instance is as given below: - From citrate synthesis of fatty acids; - Amino acid synth
Echinodermata - Regeneration in Invertebrates Asteroids (starfishes), ophiuroids (brittle stars) and crinoids (sea lilies) can reproduce their lost arms and although parts of
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd