Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Can you explain Cholera?
Cholera is one of the diseases which had caused epidemics all over the world. The organism which causes the disease is Vibrio cholerae. It is an aerobic, facultatively anaerobic, straight or slightly curved, short, gram-negative, oxidose-positive rod with a single flagellum.
The K cholerae produces a heat-sensitive enterotoxin while growing in the human intestine. It causes the characteristic cholera symptoms including 'rice water stool'. The toxin is heat labile. The incubation period of cholera ranges from a few hours to 5 days but usually between 2-3 days. The symptoms include abrupt onset of vomiting and watery diarrhoea. Diarrhoea has a rice water appearance, where the stools look like water with flecks of rice in it hence the name 'rice water stool'. Dehydration may be followed, causing death in some cases, if prompt electrolyte supplementation is not provided. Antibiotic treatment helps in reducing the duration of the disease by killing the organisms before they become bound to mucosa.
What is Lymphatic Network? The lymphatic network consists of the lymphatic vessels, which circulate lymph throughout the body. Lymph is a liquid which carries out exchange of g
Which of the following is a false statement regarding the activity of DNA polymerase during the replication process? A. DNA polymerase reads the template strand in the 5' to 3
Analyse the model that highlights the factors which influence the environmental impact of a population
Explain about Urinary system Urinary system provides us with the service of disposing the waste products carried by blood. This function is also known as excretion.
Explain about the Parkinson's disease? Parkinson's disease is a degenerative central nervous system (CNS) condition characterized by progressive loss of cells within substantia
what is atp explain in detail?
Aeromonas associated zoonotic disease Aeromonas causes gastrointestinal infections and extra intestinal infections such as cellulitis, wound infectiopn, peritonitis, endocardi
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
BLOO D PRESSURE Is the result of the sum of (i) Osmotic colloidal pressure of blood (ii) Elastic recoil of blood vessel's wall.
Define the Enzyme Function of Vitamin C? Vitamin C acts as an electron donor for 11 enzymes. Three of those enzymes are found in fungi but not in humans. Of the eight remainin
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd