Can you explain anticodon, Biology

Assignment Help:

Q. How are amino acids brought to the cellular site where translation takes place? What is an anticodon?

Amino acids are brought to ribosomes by RNA molecules known as transfer tRNA, or RNA. One tRNA associated to its specific amino acid binds by a special sequence of three nucleotides to an mRNA codon exposed in the ribosome. This sequence in the tRNA is known as anticodon the tRNA anticodon must be complementary to the mRNA codon to which it binds, according to the rule CG, A- U. The ribosome then slides along the mRNA molecule a process called translocation to expose the following codon to the binding of other tRNA. When amino acids corresponding to neighboring codons bind by peptide bond the first tRNa is liberated.


Related Discussions:- Can you explain anticodon

Measures to be taken to avoid fire and in event of a fire, (a)    Bedroom ...

(a)    Bedroom :                    ·           Do not place room heaters near any inflammable materials.                  ·           Do not use heaters

Can you explain about cardiomyopathies, Q. Can you explain about Cardiomyop...

Q. Can you explain about Cardiomyopathies? Cardiomyopathy is a primary disorder of heart muscle that may cause cardiac dysfunction and is not related to any obvious disease pr

Enumerate implant materials with their pros and cons, Enumerate different i...

Enumerate different implant materials with their pros and cons Biomaterials fall into four categories: metal and metal alloys, ceramics (carbon included in this group) syntheti

Explain the toxicity of nicotinic acid, Explain the Toxicity of nicotinic a...

Explain the Toxicity of nicotinic acid? Although therapeutically useful in lowering serum cholesterol, administration of chronic high oral doses of nicotinic acid can lead to h

Decreased performance of the removable prosthesis, Removable soft tissue-bo...

Removable soft tissue-borne partial dentures have one of the lowest patient acceptance rates in dentistry. Those patients wearing the partial dentures often exhibit greater mobilit

Excretory system - ureters, URETERS From hilum of each kidney emerge...

URETERS From hilum of each kidney emerges out a tube. Wall is thick. Lumen is star shaped. 28 cm. long. Transitional epithelium present in wall. Open in to urinary bla

Precautions for estimation of sucrose by fehling soxhlet, Explain Precautio...

Explain Precautions for Estimation of Sucrose by Fehling Soxhlet Method? 1. Maintain proper temperature of the water bath for complete hydrolysis. 2. Add distilled water to

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is antimicrobial resistance, Question 1 What is antimicrobial resista...

Question 1 What is antimicrobial resistance? List the reasons for antimicrobial resistance. Explain why antimicrobial resistance is a global concern. Add a note on various mechani

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd