Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. How are amino acids brought to the cellular site where translation takes place? What is an anticodon?
Amino acids are brought to ribosomes by RNA molecules known as transfer tRNA, or RNA. One tRNA associated to its specific amino acid binds by a special sequence of three nucleotides to an mRNA codon exposed in the ribosome. This sequence in the tRNA is known as anticodon the tRNA anticodon must be complementary to the mRNA codon to which it binds, according to the rule CG, A- U. The ribosome then slides along the mRNA molecule a process called translocation to expose the following codon to the binding of other tRNA. When amino acids corresponding to neighboring codons bind by peptide bond the first tRNa is liberated.
(a) Bedroom : · Do not place room heaters near any inflammable materials. · Do not use heaters
Q. Can you explain about Cardiomyopathies? Cardiomyopathy is a primary disorder of heart muscle that may cause cardiac dysfunction and is not related to any obvious disease pr
Enumerate different implant materials with their pros and cons Biomaterials fall into four categories: metal and metal alloys, ceramics (carbon included in this group) syntheti
Explain the Toxicity of nicotinic acid? Although therapeutically useful in lowering serum cholesterol, administration of chronic high oral doses of nicotinic acid can lead to h
Removable soft tissue-borne partial dentures have one of the lowest patient acceptance rates in dentistry. Those patients wearing the partial dentures often exhibit greater mobilit
what is the general characteristic of aschelminths
URETERS From hilum of each kidney emerges out a tube. Wall is thick. Lumen is star shaped. 28 cm. long. Transitional epithelium present in wall. Open in to urinary bla
Explain Precautions for Estimation of Sucrose by Fehling Soxhlet Method? 1. Maintain proper temperature of the water bath for complete hydrolysis. 2. Add distilled water to
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Question 1 What is antimicrobial resistance? List the reasons for antimicrobial resistance. Explain why antimicrobial resistance is a global concern. Add a note on various mechani
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd