Can be made from set of 20 naturally occurring amino acids, Biology

Assignment Help:

How many different molecules composed of (A) two (B) three, and (C) four amino acids, linked together by peptide bonds, can be made from the set of 20 naturally occurring amino acids?

Related Discussions:- Can be made from set of 20 naturally occurring amino acids

How nondisjunction in meiosis i and meiosis ii look in males, How does nond...

How does nondisjunction in meiosis I and meiosis II look in males and females? Diagram it.

What are persistent organic pollutants, What are persistent organic polluta...

What are persistent organic pollutants (POPs)? POPs, or persistent organic pollutants, are toxic substances formed from organic compounds. POPs are made in several industrial p

Explain noncompetitive inhibitor, Explain noncompetitive inhibitor A no...

Explain noncompetitive inhibitor A noncompetitive inhibitor can combine with either the free enzyme or the enzyme- substrate complex, interfering both. The most common ty

Explain the role of lipoprotein, Explain the Role of Lipoprotein ? As d...

Explain the Role of Lipoprotein ? As discussed in the previous section, serum concentrations of Lp(a) are elevated in South Asians irrespective of their migrant status. Several

Transport of substances done across the bryophyte tissues, Q. How is the tr...

Q. How is the transport of substances done across the bryophyte tissues? How is this feature related to the general size of these plants? In bryophytes there are no nutrient-co

Which is the muscle tissue that moves the bones, Q. Which is the kind of mu...

Q. Which is the kind of muscle tissue that moves the bones? The bones are moved by the skeletal striated muscles these muscles are voluntary (controlled by volition).

What are the reproductive novelties, Q Do beings of the class Reptilia have...

Q Do beings of the class Reptilia have indirect or direct development? In beings of the class Reptilia the embryonic development is direct. So there is no larval stage. Q.

Explain the plaque assessment, Plaque Assessment Microbial films have b...

Plaque Assessment Microbial films have been known to form on inert biomaterial surfaces in an aqueous environment. Implants placed in the oral cavity are no exception and repre

Biomaterials and osseointegration, During the last 90 years, man-made mater...

During the last 90 years, man-made materials and devices have been developed to replace parts of living systems in the human body. These special materials function in intimate cont

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages