Calcium - mineral elements, Biology

Assignment Help:

CALCIUM

It is the most abundant mineral of animal body.

Calcium is available in all types of vegetables, grain, milk, cheese, eggs, fish and butter.

By its deficiency rickets, tetanus & paget disease is caused.

For absorption of Ca PTH is must.

It helps in -

(a) Formation of bones and teeth.

(b) It is required for exocytosis of endocrine glands.

(d) Working of muscles.

(e) Blood clotting.

(f) Membrane permeability.

(g) As constituent of calcium pectate in middle lamella.

(h) As constituent of exoskeleton of many invertebrates and molluscan shells. (i) It acts as activator of some enzymes like ATP-ase, phospholipase, etc.

(j) To control heart beat.

Related Discussions:- Calcium - mineral elements

Organisation of nervous system, Organisation of Nervous System Nervou...

Organisation of Nervous System Nervous systems are composed of nerve cells or neurons and glial cells. In the latter half of the 19 th century it was strongly believed that

What are mitochondria, Mitochondria are the organelles in which the most si...

Mitochondria are the organelles in which the most significant part of the cellular respiration happens: the ATP production.

Bacterial flagella structure and protocol, #qprokroyotic flagella struct...

#qprokroyotic flagella structure and protocoluestion..

Explain adverse effects of tenofovir disoproxil fumarate, Adverse effects o...

Adverse effects of Tenofovir disoproxil fumarate The most common adverse effects have been nausea, vomiting and diarrhea. Renal failure, including a Fanconi-like syndrome, has

Explain the obligatory losses of nutrients, Explain the Obligatory Losses o...

Explain the Obligatory Losses of Nutrients? Obligatory losses of nutrient are defined as 'the losses that occur when an individual is put on a diet free of that nutrient'. For

#tmolecular basis of inheritence.., which is the molecular basis of inherit...

which is the molecular basis of inheritennce

Explain the reproductive system, Explain the Reproductive System? The h...

Explain the Reproductive System? The human reproductive system produces not only reproductive organs and gametes, but also sex hormones, which have far-reaching effects on huma

About ribosome, Which type Ribosome occurs exclusivley in Mitocondria?

Which type Ribosome occurs exclusivley in Mitocondria?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Limnology, Limnology : It is the study of organisms present in rivers or fr...

Limnology : It is the study of organisms present in rivers or fresh water lakes. Limnology is also called as freshwater science. This is the study of inland waters. Limnology is of

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages