Briefly explain about semantides, Biology

Assignment Help:

Q. Briefly explain about semantides?

The information carrying molecules in plants are called semantides, and they have been recognised to be 3 kinds; deoxyribonucleic acid or DNA (primary semantide), ribonucleic acid or RNA (secondary semantide) and proteins (tertiary semantide) following the sequential transfer of the genetic code. Of these, the proteins are the most favoured molecules for chemotaxonomic purposes. Plant proteins can be studied by different methods; by electrophoresis or by serological methods, and both processes have been used for obtaining information about the protein chemistry of different plants.

In the common bread wheat, Triticum aestivum, the storage proteins were analysed by. electrophoresis. For comparative purposes, the storage proteins of the- tetraploid wheat, Triticum dicoccum and the dipliod grass Aegilops Squarrosa were also analysed electrophoretically study confirmed the conclusion that the hexaploid wheat did contain a sum of the proteins possessed by the diploid species which have contributed to the evolution of the hexaploid wheat. This study supports the observations based
on morphology and cytological evidence

Serological analysis of proteins is based on the immunological reaction shown by mammals when a foreign protein is introduced into the system. In other words, this is based on the antibody-antigen reaction, the antibodies being specific to an antigen bringing about coagulation. This information can then be analysed to understand the relationships of the different plants on the basis of the serological evaluation of the plant proteins. Serology has proved a useful taxonomic tool at different levels of classification. J. G. Hawkes (1960) and his co-workers studied several tuber-producing species of Solanum to understand the evolution of the cultivated potato Solanum tuberosum and determine the species of Solanum which could be established as the ancestors of the common cultivated potato, Similarly, in the family Ranunculaceae, serological studies supported cytological data for the classification of the family into tribes and genera. Fair brothers (1959) and his CO-workers have studied several plant groups serologically particularly the members of grass family. A general conclusion from such studies is that the different amount of serological activity in members of, different plant families may be interpreted as a reflection of the evolutionary differences in the primary structure of the proteins due to which serological differences can be recognised between members of different families.


Related Discussions:- Briefly explain about semantides

Thermal relations, Normal 0 false false false EN-IN X...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Where are the adrenal glands located, Q. Where are the adrenal glands locat...

Q. Where are the adrenal glands located? How many are they and what are their portions? Each adrenal gland is located on the top of each kidney (forming a hat-like structure fo

Is calcium-sensing receptors serves as a sensor, Which of the following ser...

Which of the following serves as a sensor, or as part of a sensor, that functions in a positive feedback system? A. CaSRs (Calcium-Sensing Receptors) situated in the plasma mem

How to investigate mitral regurgitation by echo, Q. How to investigate mitr...

Q. How to investigate mitral regurgitation by Echo? 2 D echocardiography will help determine the morphology and etiology of mitral regurgitation. Rheumatic mitral regurgitation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the most probable mode of inheritance, In the following pedigrees...

In the following pedigrees, the disorders or traits presented follow simple patterns of Mendelian inheritance. For each trait, determine the most probable mode of inheritance, stat

Saprophetic mode of nutrition , how parasitic protozoans exibit saprophtic ...

how parasitic protozoans exibit saprophtic mode of nutrition

To show that growing seeds take in oxygen, To show that growing seeds take ...

To show that growing seeds take in oxygen Cork up one end of a tube, having first placed inside some damp cotton wool and some mustard seeds. Immerse the open end in dilute ca

Define peri-implantitis, What is peri-implantitis? Peri-implantitis as ...

What is peri-implantitis? Peri-implantitis as defined by Meffert is the progressive loss of peri-implant bone as well as soft tissue inflammatory changes. Bacterial invasion of

State the lantern test of eye, State the Lantern Test  The patient nam...

State the Lantern Test  The patient names colours displayed in the lantern and the mistakes are analyzed. This is not the best method of testing because it depends on the natu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd