Breathing or ventilation, Biology

Assignment Help:

VENTILATION OR BREATHING -

15-16 / minute (In Rabbit 36-38). In children 35 / 1 minute.

1.      INSPIRATION

  • In take of air is known as inspiration. First of all external I.C.M. is contracted.
  • Ribs become straight. Sternum comes out 1.5 cm. It is thoracic breathing (25%).
  • Radial muscles of diaphragm are contracted. It becomes flat.
  • It is abdominal breathing or true breathing (75%). Both breathing collectively known as Eupnia.
  • Thoracic breathing takes place in deep breath only. It gets stimulation from cerebrum.
  • Due to all volume of thoracic cavity is increased & pressure is decreased. (1-3 mm Hg than 760 mm Hg).
  • To fullfil this pressure air enters into lungs.

1574_inspiration and expiration.png

2.      EXPIRATION -

  • All muscles are relaxed so it is passive process. Volume is decreased.
  • Pressure is increased (1-3 mm Hg than 760 mm Hg). Air is given out.

Related Discussions:- Breathing or ventilation

What is maturation and adaptation, Maturation and adaptation: (18 to 54 wee...

Maturation and adaptation: (18 to 54 weeks) The final stage involves maturation and adaptation of the implant-bone interface, peri-implant bone and the entire implant supportin

Explain cloning vector, Cloning vector: The DNA molecule originating from ...

Cloning vector: The DNA molecule originating from the virus, a plasmid, or the cell of a higher organism into which an another DNA fragment of appropriate size can be integrated w

Hemiplegic migraine and ophthalmologic migraine, Hemiplegic migraine and op...

Hemiplegic migraine and ophthalmologic migraine These are relatively rare and include loss of movement of the limbs and eyes, respectively.

Explain thalamus and hypothalamus, Q. Explain Thalamus and Hypothalamus ? ...

Q. Explain Thalamus and Hypothalamus ? Thalamus and Hypothalamus: The thalamus is situated in the forebrain at the uppermost part of the diencephalon (posterior part of the for

Difference between "a" and "i" bands, DIFFERENCE S BETWEEN "A" AND "I" BAN...

DIFFERENCE S BETWEEN "A" AND "I" BANDS     A-Ban d (Anisotropic band)   I-Ban d (Isotropic band) 1. It

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain working of cerebral cortex, Q. Explain working of Cerebral Cortex? ...

Q. Explain working of Cerebral Cortex? Cerebral Cortex/Cerebrum: The cerebrum or the cortex is the large part of the brain and is associated with the cognitive functions of the

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd