Bovine spongiform encephalopathy, Biology

Assignment Help:

Bovine spongiform encephalopathy

The bovine transmissible spongiform encephalopathy (BSE), known as 'mad cow disease'-first noticed in Great Britain in 1986, is similar to scrapie in sheep and Creustfeld Jacob syndrome (CJD) in man, chronic wasting disease of captive mule deer and rocky mountain elk and transmissible encephalopathies in mink. It has been reported from Northern Ireland, the Republic of Ireland, Oman, Switzerland, France, Germany and a few other European countries. There is no report of BSE in India so far although doubtful cases of CJD in human beings have been reported. The causative agent is structurally different from a virus in that it contains protein (PrP) which is a transformed naturally occurring protein constituent of neurons that is encoded by a single chromosomal gene and devoid of nucleic acid. This agent measures 30-50 nm and is extremely resistant to inactivation by heating, UV-irradiation and many chemicals. BSE is classified as Prion disease.


Epidemiology: The disease in cattle occurred as a result of feeding them with ruminant protein supplements in meat and bone-meal derived from scrapie-affected sheep.


Symptoms:
It is difficult to diagnose the disease on the basis of clinical signs since such signs are not quite spectacular. Histopathological and histochemical studies, electron microscopy and biochemical analysis for detection of prion protein are presently available for laboratory confirmation of the disease.Prevention, control and treatment: Identification and slaughtering of positive and suspected cases are the only means of control measures available at present


Related Discussions:- Bovine spongiform encephalopathy

Explain the objectives of congenital heart disease, Explain the Objectives ...

Explain the Objectives of Congenital Heart Disease ? After reading this unit, you should be able to: 1 Comprehenced the epidemiologic significance of congenital heart disease (

Nutrition, examples of heterotrophic nutrition

examples of heterotrophic nutrition

Define absorption, Define Absorption, Storage and Elimination of vitamins? ...

Define Absorption, Storage and Elimination of vitamins? Reading through this section you would realize that all fat-soluble vitamins undergo similar metabolic fate. They are a

Determine the term - essential element, Determine the term - essential elem...

Determine the term - essential element It becomes difficult to meet all the conditions so as to establish essentiality. This is particularly so for the elements that are requir

Reaction of the futile cycle, Reaction of the futile cycle:- A) An  ade...

Reaction of the futile cycle:- A) An  adequate level of  cAMP  stimulates formation of  the  inactive  'D'  form  of glycogen synthase and the active form of phosphorylase. Thu

Blood salvage and bloodless open-heart surgery, Blood Salvage and Bloodless...

Blood Salvage and Bloodless Open-heart Surgery: At the time of cardio pulmonary bypass, cardiomony suckers suck blood from the chambers or the heart and pericardium back into the

Explain insect resistance, In 2003 nearly 70 million hectares globally were...

In 2003 nearly 70 million hectares globally were planted in genetically modi?ed crops. Of these, 73%  were plants such as soybean, corn and cotton, which were modi?ed to be he

What is ceramics, What is Ceramics A kind of material that is "bone lik...

What is Ceramics A kind of material that is "bone like" based on the specific ratios of calcium and phosphorous in particular crystalline structures. Ceramics are inorganic, no

Define absorption of calcium from dietary calcium supplement, Define Absorp...

Define Absorption of Calcium from dietary calcium supplements? Absorption from dietary calcium supplements is important to know, since they are almost universally recommended f

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd