Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Bovine spongiform encephalopathy
The bovine transmissible spongiform encephalopathy (BSE), known as 'mad cow disease'-first noticed in Great Britain in 1986, is similar to scrapie in sheep and Creustfeld Jacob syndrome (CJD) in man, chronic wasting disease of captive mule deer and rocky mountain elk and transmissible encephalopathies in mink. It has been reported from Northern Ireland, the Republic of Ireland, Oman, Switzerland, France, Germany and a few other European countries. There is no report of BSE in India so far although doubtful cases of CJD in human beings have been reported. The causative agent is structurally different from a virus in that it contains protein (PrP) which is a transformed naturally occurring protein constituent of neurons that is encoded by a single chromosomal gene and devoid of nucleic acid. This agent measures 30-50 nm and is extremely resistant to inactivation by heating, UV-irradiation and many chemicals. BSE is classified as Prion disease.
Epidemiology: The disease in cattle occurred as a result of feeding them with ruminant protein supplements in meat and bone-meal derived from scrapie-affected sheep.
Symptoms: It is difficult to diagnose the disease on the basis of clinical signs since such signs are not quite spectacular. Histopathological and histochemical studies, electron microscopy and biochemical analysis for detection of prion protein are presently available for laboratory confirmation of the disease.Prevention, control and treatment: Identification and slaughtering of positive and suspected cases are the only means of control measures available at present
Explain the Objectives of Congenital Heart Disease ? After reading this unit, you should be able to: 1 Comprehenced the epidemiologic significance of congenital heart disease (
examples of heterotrophic nutrition
Define Absorption, Storage and Elimination of vitamins? Reading through this section you would realize that all fat-soluble vitamins undergo similar metabolic fate. They are a
Determine the term - essential element It becomes difficult to meet all the conditions so as to establish essentiality. This is particularly so for the elements that are requir
Reaction of the futile cycle:- A) An adequate level of cAMP stimulates formation of the inactive 'D' form of glycogen synthase and the active form of phosphorylase. Thu
Blood Salvage and Bloodless Open-heart Surgery: At the time of cardio pulmonary bypass, cardiomony suckers suck blood from the chambers or the heart and pericardium back into the
In 2003 nearly 70 million hectares globally were planted in genetically modi?ed crops. Of these, 73% were plants such as soybean, corn and cotton, which were modi?ed to be he
What is Ceramics A kind of material that is "bone like" based on the specific ratios of calcium and phosphorous in particular crystalline structures. Ceramics are inorganic, no
Define Absorption of Calcium from dietary calcium supplements? Absorption from dietary calcium supplements is important to know, since they are almost universally recommended f
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd