blood group, Biology

Assignment Help:
when the father and the mother of a newborn baby possesses blood group ''O'' +ve,is it possible that the baby can have a blood group ''A'' +ve or ''B''+ve ? Conventionally it should be ''O''+ve again for the baby too.But taking into consideration the dominant gene will it be possible that the baby can have a blood group ''A''+ve or ''B'' +ve or AB +ve?If yes, how and why?

Related Discussions:- blood group

False positive st changes, Q. False Positive ST Changes? 1) The slope ...

Q. False Positive ST Changes? 1) The slope of the PQ-segment can help predict the magnitude of the influence of P-wave depolarization and thus help predict which patient wou

Which substance starts clotting in humans after a wound, When a wound occur...

When a wound occurs in humans, platelets in the blood activate a substance that starts clotting process. The substance which starts clotting is: a) Adenosine (pron: ah-den-ah-s

Define maternal dietary intake and foetal outcome, Define Maternal Dietary ...

Define Maternal Dietary Intake and Foetal Outcome? Among the various nutrients, energy intake appears to be the most crucial, for developing countries. Studies from India have

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define characteristic of doppler echocardiographic, Q. Define characteristi...

Q. Define characteristic of Doppler Echocardiographic? Ans. Doppler findings of cardiac tarnponade are based on the following characteristic respiratory variations in intr

Why is maternal milk important for baby, Q. Why is maternal milk important ...

Q. Why is maternal milk important for the immune protection of the baby? Besides being nutritionally important like maternal milk participates in the defense of the baby agains

Genetics, what about cytoplasmic sex determination

what about cytoplasmic sex determination

List various criteria for optimum health, List various criteria for optimum...

List various criteria for optimum health and satisfactory health according to implant quality scale The criteria for Optimum health according to Implant quality scale are: -

Define the activation of an agonist during movement, Explain the relationsh...

Explain the relationship between an agonist muscle and its antagonist as it relates to positional control, functional movement and neuromuscular activation. For example, how the th

Reproductive systems, compare the lengths and paths of the uterine tubes (o...

compare the lengths and paths of the uterine tubes (oviducts) of the cat and the human

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd