Blood collection, Biology

Assignment Help:

Blood Collection:

Blood for analysis may be obtained from veins, arteries, or capillaries. Venous blood is usually the specimen of choice, and venipuncture is the method for obtaining this specimen.

In young children skin puncture is frequently used to obtain what is predominantly capillary blood. Arterial puncture is used mainly for blood gas analysis.

Tourniquet should not be left in position for more than one minute (marked changes of hemoconcentration is observed after 3 min.), and the patient should not allowed to pump his or her fist while the tourniquet is in place (it cause an increase in plasma potassium, phosphate, and lactate concentration).

Stress associated with blood collection can have effects in patients at any age. Plasma concentration of cortisol and growth hormone may increase.

 


Related Discussions:- Blood collection

Living Environment- Cells, What happens to a cell when placed in a salt sol...

What happens to a cell when placed in a salt solution and then into distilled water?

Merits of micro propagation, Merits of Micro Propagation The special m...

Merits of Micro Propagation The special merits of micro propagation are: 1. It considerably increases the rate of multiplication 2. High rate of multiplication can be ma

Foods incriminated, Foods that are frequently incriminated in staphylococca...

Foods that are frequently incriminated in staphylococcal food poisoning include meat and meat products, poultry and egg products, egg, tuna, chicken, potato and macaroni, bakery pr

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe how micrornas are able to influence gene expression, 1. Transcript...

1. Transcriptional analyses of eukaryotic cells reveal widespread production of RNA. Using specific examples describe how: a) microRNAs are able to influence gene expression.

Animal tissue, Animal Tissue A tissue is a group of cells that are si...

Animal Tissue A tissue is a group of cells that are similar in structure, origin and function. Tissue word coined by Bichat (Father of Histology). Histology term

Define some precautions for estimation of amount of bacteria, Define some P...

Define some Precautions for Estimation of the Amount of Bacteria? 1. Dilution should be made carefully. 2. Use fresh sterile pipette for making each dilution. 3. Aseptic

Where can rna are found within cells, Q. Where can RNA are found within cel...

Q. Where can RNA are found within cells? In the eukaryote cell nucleus the RNA can be found to dispersed in the nuclear fluid, along with the DNA, and as the main constituent o

Treatment of angina pectoris, Q. Treatment of angina pectoris? Proper a...

Q. Treatment of angina pectoris? Proper and careful treatment of the underlying cause (usually dyslipidemia, advanced atherosclerosis or sever chronic hypertension) is imperati

Chest complications-peri operative problems, Chest Complications : Many of...

Chest Complications : Many of the patients undergoing coronary artery bypass surgery have risk factors for post-operative lung complications. These include old age, chronic obstru

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd