Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Blood Collection:
Blood for analysis may be obtained from veins, arteries, or capillaries. Venous blood is usually the specimen of choice, and venipuncture is the method for obtaining this specimen.
In young children skin puncture is frequently used to obtain what is predominantly capillary blood. Arterial puncture is used mainly for blood gas analysis.
Tourniquet should not be left in position for more than one minute (marked changes of hemoconcentration is observed after 3 min.), and the patient should not allowed to pump his or her fist while the tourniquet is in place (it cause an increase in plasma potassium, phosphate, and lactate concentration).
Stress associated with blood collection can have effects in patients at any age. Plasma concentration of cortisol and growth hormone may increase.
What happens to a cell when placed in a salt solution and then into distilled water?
Merits of Micro Propagation The special merits of micro propagation are: 1. It considerably increases the rate of multiplication 2. High rate of multiplication can be ma
Foods that are frequently incriminated in staphylococcal food poisoning include meat and meat products, poultry and egg products, egg, tuna, chicken, potato and macaroni, bakery pr
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
1. Transcriptional analyses of eukaryotic cells reveal widespread production of RNA. Using specific examples describe how: a) microRNAs are able to influence gene expression.
Animal Tissue A tissue is a group of cells that are similar in structure, origin and function. Tissue word coined by Bichat (Father of Histology). Histology term
Define some Precautions for Estimation of the Amount of Bacteria? 1. Dilution should be made carefully. 2. Use fresh sterile pipette for making each dilution. 3. Aseptic
Q. Where can RNA are found within cells? In the eukaryote cell nucleus the RNA can be found to dispersed in the nuclear fluid, along with the DNA, and as the main constituent o
Q. Treatment of angina pectoris? Proper and careful treatment of the underlying cause (usually dyslipidemia, advanced atherosclerosis or sever chronic hypertension) is imperati
Chest Complications : Many of the patients undergoing coronary artery bypass surgery have risk factors for post-operative lung complications. These include old age, chronic obstru
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd