Blood coagulation factor - circulation, Biology

Assignment Help:

Blood coagulation factor - Circulation

The catalytic sequence of events behaves like an enzyme cascade with each product of a reaction being responsible for the activation of the next reaction. At least 13 different plasma factors have been recognised. A deficiency of even one factor can delay or prevent clotting. Why has such a complex mechanism evolved? Maybe it is essential to have a number of initial clotting responses to a variety of internal and external stimuli that can cause haemorrhage. At the same time, any ambiguous stimuli would not be able to cause intravascular clotting when no injury occurs. Coagulation of blood is inhibited by heparin, a mucopolysaccharide that can be isolated from mammalian liver. A haemostatic mechanism is necessary for most animals. In open circulation the contraction of blood vessel to prevent blood loss does not help, but then open systems have low blood pressure and thus decrease the ' chances of large blood losses.

                                                 Table: Blood coagulation factor

1068_Blood coagulation factor - Circulation.png

Clotting mechanisms are also seen in invertebrates. The simplest mechanism is the agglutination of blood corpuscles without the involvement of plasma proteins. A cellular meshwork forms which helps to close the wound. Contraction of muscles also helps in this process.


Related Discussions:- Blood coagulation factor - circulation

Blood protozoan and ricketsial diseases - trypanosomiasis, B l oo d Prot...

B l oo d Protozoan and Ricketsial Diseases T r y p a n o s o m i a si s It is also known as surra in equines and tibarsa in camel and results in intermitte

Show the recessive phenotype, A woman who is heterozygous for a particular ...

A woman who is heterozygous for a particular X-linked recessive trait marries a phenotypically normal man. What percentage of their sons will show the recessive phenotype?

Final common pathway of the degradation of organic compounds, Q. Why is the...

Q. Why is the Krebs cycle also called the final common pathway of the degradation of organic compounds? The Krebs cycle is known as the final common pathway of the degradation

Define the concepts of lipids, Define the Concepts of Lipids? You have ...

Define the Concepts of Lipids? You have studied the classification of lipids in your theory lesson. Lipids, you learnt, are classified as simple, compound or derived lipids on

Meiosis comprises two separate divisions, All of the following make meiosis...

All of the following make meiosis different from mitosis; EXCEPT A. Meiosis comprises two separate divisions. B. Meiosis only occurs during embryonic development. C. Chromoso

Show the directly visible chemical characters, Q. Show the Directly Visible...

Q. Show the Directly Visible Chemical Characters? Very few chemical substances in plants can be observed directly, but the few substances such, starch grains which are pres

Domestication - wildlife, Domestication - Wildlife It means that man h...

Domestication - Wildlife It means that man has taken under his direct care the living beings which are useful to him. Through extensive breeding programmes, he has modified th

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd