Blood coagulation, Biology

Assignment Help:

BLOOD COAGULATION -

 

DEFINITION -

The property of blood to change from fluid to gel state within a few minutes of its coming in contact with air is called blood coagulation or blood clotting or haemostasis.

 

PERIOD -

The clot begins to develops in 15 to 20 seconds but is fully formed within 3 to 6 minutes in a normal person.

 

FACTORS INVOLVED -

According to internation commission on blood coagulation (1954), thirteen coagulation factors are involved -

I.        Fibrinogen (synthesized in liver)

II.       Prothrombin (synthesized in liver)

III.      Thromboplastin (a lipoproteinous enzyme released from damaged tissues blood plateles in mammals).

IV.      Calcium ion (activates thromboplastin).

V.       Labile factor or proaccelerin (synthesized in liver).

VI.      Accelerin (Hypothetical factor, the term is no longer used).

VII.     Stable factor or proconvertin (synthesized in liver).

VIII.    Antihaemophilic factor (AHF - synthesized in liver. Its deficiency causes haemophilia-A).

IX.      Christmas factor or plasma thromboplastin component (PTC-synthesized in liver). Its deficiency causes haemophilia-B or christmas disease.

X.       Stuart Power factor (synthesized in liver)

XI.      Plasma thromboplastin antecedent (PTA-synthesized in liver). Its deficiency causes haemophilia-C.

XII.     Hageman or surface factor (activated when comes in contact with skin surface).

XIII.    Fibrin - Stabilizing factor (FSF)


Related Discussions:- Blood coagulation

Define dietary factors with antinutritional effects, Define Dietary Factors...

Define Dietary Factors with Antinutritional Effects? In the above sections, we have learnt about a variety of food components having a host of health promotive properties. Let

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe metabolic acidosis and respiratory acidosis, Q. What is the differ...

Q. What is the difference between metabolic acidosis and respiratory acidosis and what is the difference between metabolic alkalosis and respiratory alkalosis? Respiratory acid

What happens to the movement of molecules at equilibrium, What happens to t...

What happens to the movement of molecules at equilibrium? At equilibrium, the movement of molecules continues, but because there is no concentration gradient, there is no net m

Bacteria and archea, Based on the scientific name. Streptococcus agalactia...

Based on the scientific name. Streptococcus agalactiae what morphology would you expect these cells to have?

Nervous system and sense organs, Nervous System and Sense Organs The n...

Nervous System and Sense Organs The non-chordates also perform a variety of activities such as feeding, digestion, locomotion etc. For this aim, they have corresponding organs

Are there non-parasitic viruses, Q Are there non-parasitic viruses? All...

Q Are there non-parasitic viruses? All viruses are necessitating intracellular parasites that are they depend on the host cell to complete their life cycle. A virus does not ha

Determine food sources of riboflavin - water-soluble vitamin, Determine the...

Determine the food sources of riboflavin? The food sources of riboflavin include: 1. Rich sources: Liver, dried yeast, egg powder, milk powder. 2. Good sources: Who

What is modified blalock-taussig shunt explain, What is Modified Blalock-Ta...

What is Modified Blalock-Taussig Shunt explain? This is usually done by interpositioning a PTFE (Goretex) graft of 3.5 or 4 mm in a neonate. It is better done by a left lateral

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd