Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
BLOOD CORPUSCLES (= BLOOD CELLS) -
Blood corpuscles are of the following three types: Erythrocytes, Leucocytes and Thrombocytes.
(A) Erythrocytes (Red Blood Corpuscles or RBCs)
LIFE SPAN -
The life of a RBC is about 120 days.
PUT NOTE -
Rouleaux -
2. Leucocytes (White Blood Corpuscles or WBCs) -
Structure -
Types -
The leucocytes are of two main types- Agranulocytes and Granulocytes.
(i) Agranulocytes -
(a) Lymphocytes -
(ii) Granulocytes -
(a) Eosinophils -
(b) Basophils -
(c) Neutrophils -
Formation -
Life Span -
3. Thrombocytes (= Blood platelets)
Spindle Cells (= Thrombocytes) -
Q. show the Symptoms of constipation? Have you ever suffered from constipation? Do you recall the symptoms associated with the problem? Yes, the symptoms were specific to havin
Q. What are the few examples of the structural function of organic molecules? Organic molecules have a structural function as they are part of cell membranes, organ walls, cyto
Pollution - Environmental Pollution Pollution refers to any undesirable change in the physical, chemical or biological characteristics of our environment, i.e. air, water and
What is Vegetarianism? Protein quality of the vegetarian diets can be improved by proper diet planning, However, under free-living conditions, vegetarianism can limit pr
Hazard Analysis Two steps recognized as preliminary and detailed analysis of hazard are taken. Preliminary Hazard Analysis (PHA) serves two aims: (i) It can expedite bringi
The oldest fossils look as though they were formed by organisms that resemble modern?
Out of 67,410 randomly selected surgeries tracked in a study in the UK, 2832 were followed by surgical site infections. a. What is the best estimate of the probability of an
Define about the Paper electrophoresis? In paper electrophoresis the sample is applied to a point on a strip of filter paper or cellulose acetate moistened with buffer solution
Q. How are antivenoms produced? Why are antivenoms an example of passive immunization? Antivenoms are obtained by the following process: the venom (antigen) is inoculated into
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd